ID: 1020120757

View in Genome Browser
Species Human (GRCh38)
Location 7:5501951-5501973
Sequence TGAGCATGGCTGGCTGCTAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020120757_1020120761 -6 Left 1020120757 7:5501951-5501973 CCAGTAGCAGCCAGCCATGCTCA 0: 1
1: 0
2: 1
3: 19
4: 180
Right 1020120761 7:5501968-5501990 TGCTCAGCTGCTGGATCTCCCGG 0: 1
1: 0
2: 2
3: 22
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020120757 Original CRISPR TGAGCATGGCTGGCTGCTAC TGG (reversed) Exonic
900576363 1:3384380-3384402 TGACCATGGGTGGCGGCTGCAGG - Intronic
900636266 1:3667260-3667282 CGGGCAGGGCTGGCTGCTTCTGG - Intronic
900766195 1:4507383-4507405 TGAGCAAGGCTGATTCCTACCGG + Intergenic
901194183 1:7431343-7431365 TGAGTAAGCCTGGCTGCTCCAGG + Intronic
902302762 1:15514186-15514208 TGAGGGTGGGTGGGTGCTACTGG - Intronic
903270519 1:22185492-22185514 TGAGCCAGGCTGGCTGCTCAGGG - Intergenic
904809276 1:33152881-33152903 GGAGCAAGGCAGGCTGCTCCTGG + Intronic
912247556 1:107976261-107976283 TGGGCATGGGTGGCTGCTGGTGG - Intergenic
912389223 1:109290356-109290378 TGTACATGGCTGGCTGTCACTGG + Intergenic
912454917 1:109790938-109790960 TGAGCAATGCTGGCAGCCACAGG - Intergenic
913037584 1:114986928-114986950 TGAGCATGGCTTCCTGACACAGG - Intronic
916817714 1:168369906-168369928 TGTGCATGGCTGGATCCCACCGG + Intergenic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
921527179 1:216232090-216232112 TGAGCATGGCAGGCAGCCAGTGG + Exonic
922478263 1:225921742-225921764 TGGGCACAGCTGGCTGGTACAGG - Intronic
1065484705 10:26226585-26226607 GGAGCAAGGCTGGTTGCTCCCGG - Intronic
1067092483 10:43275306-43275328 TCAGCAGGGCTGGTTGCTTCTGG - Intergenic
1067767669 10:49099292-49099314 TAAGCATTGCTGGATGCTGCTGG - Intronic
1070706911 10:78646440-78646462 TTAGCAGGGCTGGCTCCTTCAGG + Intergenic
1072836677 10:98722345-98722367 TAAGCATTGCTGGCAGCCACCGG + Intronic
1074016983 10:109544382-109544404 TGACCATCTCTGGCTGATACAGG + Intergenic
1076866766 10:133170310-133170332 TGAGGATCGCTGGCTCCTGCAGG + Intronic
1077289939 11:1784389-1784411 TGGGCAGGGCTGGCTTCTCCTGG + Intergenic
1078831042 11:14977281-14977303 TGGGCATGTCTGCCTGCTTCAGG + Intronic
1080639282 11:34149403-34149425 TGAGCATGGGTTGCATCTACAGG - Intergenic
1084430272 11:69106994-69107016 TGAGCATGAATGGTTGCAACAGG + Intergenic
1087338262 11:96870047-96870069 TGAGCATGGCTGGCTGGAATAGG + Intergenic
1088262272 11:107955362-107955384 TGAGCATTCCAGGCTGCTAGAGG + Intronic
1088897568 11:114089926-114089948 TGAGCCTGGCTGGCTGCCCCAGG - Intronic
1089612545 11:119677531-119677553 TGAGCAGGGCTGGCTGCCAGGGG - Intronic
1089739756 11:120574242-120574264 TGATCGTGGATGGCTGCTCCCGG - Intronic
1090418457 11:126557103-126557125 TGAGCAGGCCTCCCTGCTACCGG - Intronic
1096661802 12:53129989-53130011 GGAGCATAGCTGGCTGCTGTTGG - Intergenic
1102597269 12:114002418-114002440 TGGGCAGGGCTGGTTGCTTCTGG + Intergenic
1103149448 12:118624207-118624229 TGAGCAAGGCTGGCAGCTGAGGG + Intergenic
1103924303 12:124415088-124415110 TCAGCATGGCTGGCACCTGCAGG - Intronic
1104439301 12:128781935-128781957 TGAGCATAGCTGCCAGCTCCCGG - Intergenic
1104569740 12:129914746-129914768 GGAGCCTGGCTGGCTGAAACAGG - Intergenic
1104713705 12:131003381-131003403 AGAGCATGGCTCTCTGCTAAGGG - Intronic
1106223261 13:27765372-27765394 TCAGCATGGCTGGTTCCTCCTGG + Intergenic
1106761189 13:32869460-32869482 TGAGCAGGGATGGCAGATACTGG + Intergenic
1108121301 13:47190063-47190085 TCAGCAGGGCTGGCTCCTTCTGG - Intergenic
1108839303 13:54592976-54592998 AGAGCATGGCAGGCTGCTTTGGG - Intergenic
1108989748 13:56640196-56640218 AGAGCATCTCTGGGTGCTACAGG + Intergenic
1110355766 13:74565247-74565269 TGAGTGTGGCTGCTTGCTACTGG + Intergenic
1112824918 13:103381396-103381418 TCAGCATGGCTGGGGGCTTCAGG + Intergenic
1112825156 13:103383347-103383369 TCAGCATGGCTGGGGGCTTCAGG + Intergenic
1113585689 13:111462755-111462777 TGAGCATTGCTGTGTGCTCCTGG + Intergenic
1113670469 13:112172231-112172253 CGAGGATGGCCGGCTGCCACCGG - Intergenic
1114389066 14:22286361-22286383 TGAGCATCCCTGGCTTCTAGAGG + Intergenic
1116932607 14:50704816-50704838 GGAGCATAGCTGGCTGCACCAGG - Intergenic
1121058788 14:90884231-90884253 CGTGCATGGCTGTCTGCTACAGG + Intronic
1121164123 14:91775523-91775545 TGAGCATAGCTGCCTTCTAAGGG - Intronic
1121773590 14:96574883-96574905 TGAGCATGCCTGCCTGCTTCTGG + Intergenic
1122153793 14:99738467-99738489 TGTGCCTGGCTGGCTGCCCCCGG + Intronic
1122275782 14:100590108-100590130 TCAGCATGGCTAGCTGATGCTGG - Intergenic
1123165428 14:106320826-106320848 TGAGCATGTCTGGAGGCTGCAGG + Intergenic
1202905355 14_GL000194v1_random:68558-68580 GGAGCACGGCTGGCTGCTCTCGG - Intergenic
1123449748 15:20352261-20352283 TCAGCAGGGCTGGCTCCTTCTGG + Intergenic
1124925165 15:34063622-34063644 TGAGGAAGGGTAGCTGCTACAGG - Exonic
1132987071 16:2772908-2772930 TCGGAATGGCTGGCTGCTTCTGG + Intronic
1134047188 16:11109518-11109540 TGAGCATTGCTGGCTTTCACCGG - Intronic
1136987847 16:35127887-35127909 TGAGCAAGGCAGGGTGCTAGAGG - Intergenic
1137370803 16:47904135-47904157 TGAGCATCGCTGGTTGCTGTGGG - Intergenic
1137422816 16:48350602-48350624 TAAGACTGGCTGGCTGCTCCAGG - Intronic
1137797023 16:51229892-51229914 TAAGCAGGGCTGGATGGTACTGG + Intergenic
1139489313 16:67278238-67278260 TGAGCAGGTCTGGCTGCCAGAGG - Exonic
1141145905 16:81529829-81529851 TGGGCAGGGCTGGCTCCTTCTGG - Intronic
1141763451 16:86043937-86043959 TGGGCATGGCTGGTTCCTTCTGG - Intergenic
1142405822 16:89889043-89889065 TGAGGATGGCTGGCTGCGATGGG + Intronic
1142966625 17:3585783-3585805 TCACCATGGCTGCCTACTACAGG - Exonic
1144206321 17:12982103-12982125 GGAGGCTGGGTGGCTGCTACAGG - Intronic
1144681702 17:17200246-17200268 TGGGCATGCCTGCCTGTTACTGG + Intronic
1144833785 17:18146030-18146052 TGAGCGGGGCTGGCTGCTGCTGG + Exonic
1145255131 17:21318201-21318223 TGAGCAAGGCCGGCTCCTCCTGG - Intergenic
1145321475 17:21769754-21769776 TGAGCAAGGCCGGCTCCTCCTGG + Intergenic
1146017608 17:29246659-29246681 TGGGCATGGCTGGCTGCTGCAGG - Intergenic
1146305829 17:31729216-31729238 TGACCAAGGCTGACTCCTACAGG + Intergenic
1147057543 17:37845909-37845931 ACAGCATGGCTGGCTGGTCCTGG - Intergenic
1147164045 17:38584115-38584137 TAAGCATGGCTGGGTTCTGCTGG + Intronic
1147900502 17:43780304-43780326 AGAGCATGGCTGGCTGCCTCTGG - Intergenic
1149083046 17:52680897-52680919 CTAGCATGGCTGGCTGCTTAGGG + Intergenic
1149593615 17:57850027-57850049 CGAGCGTGACTAGCTGCTACCGG + Exonic
1151172251 17:72256834-72256856 TGAGCTTGGCTGTCTTCTGCAGG - Intergenic
1152338892 17:79713629-79713651 TCAGCAGGGCTGGCTTCTTCTGG - Intergenic
1157245277 18:46048319-46048341 TCAGCAAGGCTGGCTCCTTCTGG - Intronic
1158418160 18:57268218-57268240 AGAGTATGGGTGGCTGATACAGG - Intergenic
1159661932 18:71107803-71107825 TAAGCATGGCTGTATACTACAGG - Intergenic
1160706588 19:532728-532750 GGCGCCTGGCCGGCTGCTACTGG - Intronic
1163037354 19:14578200-14578222 TGAGAGTGGCTGGCTGGTATTGG + Intergenic
1163796431 19:19340886-19340908 TGGGCATGGCTGGATGCAGCTGG + Intronic
1167254454 19:48418896-48418918 TGAGAATGGCTGCCTCCTAGGGG + Intronic
1168673503 19:58259163-58259185 TCAGCATGACTGGCTGCATCTGG - Intronic
925920025 2:8632060-8632082 TAAGCAGGGCTGGCTCCTTCTGG + Intergenic
927851262 2:26501123-26501145 TGAGCATGTCTGGTGGCTGCTGG - Intronic
928247611 2:29644671-29644693 TGAGCATATCTGGTTGCTAGGGG - Intronic
928612286 2:33002412-33002434 TGAGGCTGGCTGGCTGCTTTAGG + Intronic
935704967 2:105848514-105848536 TGAGCATGGCTGACTCTTACAGG - Intronic
936479248 2:112869727-112869749 TGAGCCTGGCTGGCTGCCAGGGG + Intergenic
936521142 2:113212831-113212853 ACAGCCTGGCTGGCTGCCACCGG + Intergenic
937146824 2:119654154-119654176 TGAGCAGTGTTGGCTGCTGCAGG - Intronic
937297268 2:120817349-120817371 TGAGCATGGCCTGCTCCTTCAGG - Intronic
937983610 2:127628761-127628783 TGAGCATGGCTGGCCTATGCAGG - Intronic
938408577 2:131046066-131046088 TGGGCAGGGCTGGGTGCTTCTGG - Exonic
941435487 2:165465869-165465891 TGAGCCTTGCTTGCTGCTGCAGG - Intergenic
945061697 2:205914929-205914951 TGTGCACGGCAGGCTGCTGCTGG + Intergenic
945749081 2:213757712-213757734 TGTGCACAGCTGCCTGCTACAGG - Intronic
946027791 2:216682365-216682387 TGAGTCGGGCTGGCTGCTTCTGG - Intronic
948149564 2:235734288-235734310 GGAGCATGGCTGGCAGGTCCTGG - Intronic
1169213928 20:3783176-3783198 TGAGCATGGCTGGCAGCTCTGGG - Intergenic
1169897771 20:10522691-10522713 TCAGCCCAGCTGGCTGCTACTGG + Intronic
1171892478 20:30728711-30728733 GGAGCACGGCTGGCTGCTCTCGG + Intergenic
1172386519 20:34537736-34537758 AGAGCAGGCCTGGCTGCTGCTGG + Intronic
1173558946 20:43988442-43988464 TGAGCATTGCTGTGTGCTCCTGG + Intronic
1173663285 20:44748840-44748862 TGGGGATGGCTGTGTGCTACTGG - Intronic
1174072931 20:47911355-47911377 TCAGCAGGGCTGGCTCCTGCTGG + Intergenic
1176624724 21:9083317-9083339 GGAGCACGGCTGGCTGCTCTCGG - Intergenic
1177370514 21:20197503-20197525 TGGTCATGGCTGACTGCCACAGG + Intergenic
1179639093 21:42735487-42735509 TGAGCATGACTGGCTATTTCTGG + Intronic
1179727539 21:43348743-43348765 TGAGCCTGGCTGGGTCCTCCGGG - Intergenic
950320949 3:12052721-12052743 TGACCAAGGCTGGCTCCTATGGG - Intronic
950467057 3:13161916-13161938 TGAGCATGACTGGCTGCCTGGGG - Intergenic
950574607 3:13824558-13824580 TGGTCATGGCTGGATGCCACAGG - Intronic
951519859 3:23601245-23601267 TGACCATGGCCGGCTCCTGCAGG - Intergenic
953906254 3:46869685-46869707 TGAGCATGTCTGCGTGCTCCTGG + Intronic
954104751 3:48403964-48403986 TCAGCAGGGCTGGCTGCCACAGG - Exonic
954526618 3:51277560-51277582 TCAGCCTGGCTTGCTGCTAATGG + Intronic
954871070 3:53767839-53767861 TGGGCATGGGGGGCTGCTTCAGG - Intronic
955322521 3:57984499-57984521 TCAGCAGGGCTGGCTCCTTCTGG - Intergenic
955503635 3:59609606-59609628 TGACTTTGGCTGGATGCTACTGG + Intergenic
959498816 3:107081567-107081589 TGAGCATTGCTGGCATCTAGTGG - Intergenic
961525230 3:127492608-127492630 TGAGCATCACTTGCTGCCACAGG + Intergenic
963229276 3:142893560-142893582 TGATCATGGCTCGCTGCAGCTGG + Intergenic
964650821 3:159009315-159009337 TGAGCATGGATGGCTTCTGTTGG + Intronic
965779763 3:172272491-172272513 GGAGAAGGACTGGCTGCTACAGG + Intronic
967605007 3:191434273-191434295 TGGGCATGGCTGGCTGTCTCTGG + Intergenic
967958701 3:194901030-194901052 TGAGCAGGGCTTGCTGCAGCCGG + Intergenic
968955274 4:3715887-3715909 TGAGGACGTCTGGCTGCTCCCGG - Intergenic
969672762 4:8598736-8598758 TAAGCAATGCTGGCTGCTAAGGG - Intronic
977646165 4:99415217-99415239 TCAGCATGGCTGGGGGCTTCAGG - Intronic
982123193 4:152161333-152161355 TGAGCAGGGGTGGCTGCTCGGGG - Intergenic
982255570 4:153448144-153448166 TTAGCATGGCTTCCTGCTAATGG - Intergenic
984822790 4:183897326-183897348 AGAGCATGCCTGGGTGCTTCTGG + Intronic
985809562 5:2073156-2073178 TGAGAATGCCTGGGTGCTGCAGG + Intergenic
986192391 5:5509524-5509546 TGAGGGTGGCTGGCTGCAGCTGG - Intergenic
986777507 5:11031369-11031391 TGTGCACAGCTGCCTGCTACAGG + Intronic
987054987 5:14182898-14182920 AGAGCAAGGGTGGCAGCTACAGG + Intronic
990967130 5:61461217-61461239 TGACCTTGCCTGGCTACTACAGG - Intronic
992620699 5:78589638-78589660 TGAGCAGAGATGTCTGCTACAGG + Intronic
995980412 5:118096045-118096067 TGAGGATGGCCAGCTGCTACAGG + Intergenic
999743094 5:154571768-154571790 AGAGCATGGCTGGGGGCTCCAGG + Intergenic
1002075669 5:176706952-176706974 TCAGCATGGCTGGGGGCTTCAGG + Intergenic
1002282824 5:178142947-178142969 TGAGCATGCCCTGCTGATACAGG - Exonic
1002382890 5:178842842-178842864 AGAGCCTGGCTGGCTGCTTCAGG - Intergenic
1002558286 5:180061496-180061518 TGAGCAGGGCTGATTCCTACTGG + Intronic
1003322909 6:5068302-5068324 TGTGTCTGGCTGGCTGCTGCAGG - Intergenic
1004228584 6:13811265-13811287 TGAGCAAGACTGGCTGCTCCTGG - Intronic
1007125605 6:39423243-39423265 TGAGGAGGGCTGGGTGTTACGGG - Intronic
1007359278 6:41343413-41343435 TGATCATGGCTCACTGCAACTGG - Intronic
1011450921 6:87490967-87490989 TGAGAATGGCAGGCTGCCAGAGG + Intronic
1013627275 6:111950747-111950769 AGAGCATGGTTGGCTGCTTCAGG + Intergenic
1015599141 6:134895470-134895492 AGACCAAGGCTGGCTGCTGCTGG + Intergenic
1015958526 6:138623022-138623044 TGAACATGCCTGGCTGTTGCAGG - Intronic
1017352222 6:153455886-153455908 TTTGCATGTCTGGCTGATACTGG + Intergenic
1017750910 6:157489831-157489853 TGATCATGGCTCACTGCTATGGG + Intronic
1018453083 6:163926962-163926984 GGAGGATGGCTGGCTGGTCCAGG + Intergenic
1019503466 7:1377480-1377502 TGGGCAGGGCTGGCTCCTTCTGG + Intergenic
1019817402 7:3211261-3211283 TGAGCCTGGCTGGGTGGTGCAGG + Intergenic
1020110643 7:5446113-5446135 TGGGCAGGGCTGGCTGCTTCTGG - Intronic
1020120757 7:5501951-5501973 TGAGCATGGCTGGCTGCTACTGG - Exonic
1020451745 7:8327400-8327422 CACGCAAGGCTGGCTGCTACAGG + Intergenic
1022474974 7:30704037-30704059 TGACCATGGTTGGTTGGTACAGG + Intronic
1023731380 7:43195402-43195424 TGGGCAAGGCTGGCTGCCTCAGG + Intronic
1028146639 7:87327226-87327248 TGAGGATGGCTGGTTGATAGAGG - Intergenic
1029899436 7:104023234-104023256 GGAGCAGGGCAGGCTGCTCCAGG - Intergenic
1034457183 7:151177074-151177096 TGGGCAGGGCTGGCTCCTTCTGG - Intronic
1034967225 7:155398871-155398893 TCAGCAGGCCTGGCTGCTTCTGG - Intergenic
1035050088 7:155993728-155993750 TGGGCAGGGCTGGCTTCTCCTGG + Intergenic
1040466890 8:47703771-47703793 TGAGCATGGCTGGAGGACACAGG + Intronic
1041628333 8:60056515-60056537 TGAGCCTGTCTGGCTGCTTAAGG - Intergenic
1042388334 8:68203300-68203322 TCAGGATGGAGGGCTGCTACAGG + Intronic
1047003153 8:120593312-120593334 TGAGCATGCGAGGCTGCCACTGG - Intronic
1052803658 9:32993133-32993155 AGAGCATGGCTGGCAGATGCAGG + Intronic
1053069276 9:35091626-35091648 GTAGCAGGGCTGGCTGCTTCAGG - Exonic
1053115873 9:35501692-35501714 GAACCATGGTTGGCTGCTACTGG - Intronic
1053287731 9:36860757-36860779 TGAGAAGGGCTGGCTTCTATGGG + Intronic
1054356346 9:64067024-64067046 GGAGCATGGCTGGCTGCTGTCGG - Intergenic
1060659742 9:125397827-125397849 TGAGCAGCGCTGGCTGGCACCGG + Intergenic
1060801057 9:126546150-126546172 GGAGCATGGCTGTCTGCCCCTGG + Intergenic
1060801598 9:126548824-126548846 GGAGCATGGCTGTCTGCCCCTGG - Intergenic
1185882151 X:3751017-3751039 TCAGCATGGCTGGGGGCTTCAGG + Intergenic
1186422657 X:9438749-9438771 TGAGCACGGCTGGTTCCTACTGG + Intergenic
1186481688 X:9901077-9901099 TGAGCAGGGCTGGTTCCTCCTGG + Intronic
1192201262 X:69068116-69068138 TGTGCCTGGCTGGCAGCTCCTGG - Intergenic
1195208729 X:102629820-102629842 TTAGCAGGGCTGGCTCCTTCTGG + Intergenic
1196110765 X:111944849-111944871 TCAGCATGGCTGGTTTCTTCTGG - Intronic
1200084540 X:153597372-153597394 TAAGCAGGGCTGGCTCCTTCTGG + Intronic
1200782821 Y:7232189-7232211 TCAGCATGGCTGGGGGCTTCAGG - Intergenic
1200841948 Y:7791247-7791269 TAAGCATGTCTGGCTTATACTGG - Intergenic
1201161235 Y:11168739-11168761 GGAGCACGGCTGGCTGCTCTCGG - Intergenic
1202087249 Y:21151910-21151932 TGGGCATGGCAGGGTGCAACTGG + Intergenic