ID: 1020123050

View in Genome Browser
Species Human (GRCh38)
Location 7:5516338-5516360
Sequence GCCCTTAAATCCAACATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020123050_1020123052 18 Left 1020123050 7:5516338-5516360 CCAGTCATGTTGGATTTAAGGGC No data
Right 1020123052 7:5516379-5516401 TTTTTTTTTGAGACGGAGTCTGG 0: 1044
1: 2927
2: 3716
3: 4006
4: 4092
1020123050_1020123051 11 Left 1020123050 7:5516338-5516360 CCAGTCATGTTGGATTTAAGGGC No data
Right 1020123051 7:5516372-5516394 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020123050 Original CRISPR GCCCTTAAATCCAACATGAC TGG (reversed) Intergenic
No off target data available for this crispr