ID: 1020125382

View in Genome Browser
Species Human (GRCh38)
Location 7:5530297-5530319
Sequence GCTCGGGAGGCGCGCTCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020125382_1020125394 7 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125394 7:5530327-5530349 CGCGCCTCCGAACTGGCGTGGGG 0: 1
1: 0
2: 0
3: 0
4: 24
1020125382_1020125393 6 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125393 7:5530326-5530348 TCGCGCCTCCGAACTGGCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 13
1020125382_1020125397 23 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125397 7:5530343-5530365 CGTGGGGTGTCCCCCATCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 89
1020125382_1020125392 5 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125392 7:5530325-5530347 CTCGCGCCTCCGAACTGGCGTGG 0: 1
1: 0
2: 0
3: 35
4: 37
1020125382_1020125398 26 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125398 7:5530346-5530368 GGGGTGTCCCCCATCTCCGGAGG 0: 1
1: 0
2: 1
3: 8
4: 87
1020125382_1020125390 0 Left 1020125382 7:5530297-5530319 CCCCCGGAGCGCGCCTCCCGAGC 0: 1
1: 0
2: 0
3: 4
4: 100
Right 1020125390 7:5530320-5530342 GCGGCCTCGCGCCTCCGAACTGG 0: 1
1: 0
2: 0
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020125382 Original CRISPR GCTCGGGAGGCGCGCTCCGG GGG (reversed) Intronic