ID: 1020126735

View in Genome Browser
Species Human (GRCh38)
Location 7:5536970-5536992
Sequence GGGCACAGCCAGGAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 448
Summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 404}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020126726_1020126735 -1 Left 1020126726 7:5536948-5536970 CCCAGCCAGGATCACCCAGTAAG 0: 1
1: 0
2: 0
3: 16
4: 168
Right 1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG 0: 1
1: 0
2: 3
3: 40
4: 404
1020126727_1020126735 -2 Left 1020126727 7:5536949-5536971 CCAGCCAGGATCACCCAGTAAGG 0: 1
1: 0
2: 0
3: 9
4: 207
Right 1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG 0: 1
1: 0
2: 3
3: 40
4: 404
1020126730_1020126735 -6 Left 1020126730 7:5536953-5536975 CCAGGATCACCCAGTAAGGGCAC 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG 0: 1
1: 0
2: 3
3: 40
4: 404
1020126724_1020126735 21 Left 1020126724 7:5536926-5536948 CCTGCTCAGAAAGGGGCAGTGAC 0: 1
1: 1
2: 3
3: 26
4: 241
Right 1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG 0: 1
1: 0
2: 3
3: 40
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020126735 Original CRISPR GGGCACAGCCAGGAGCTGAA GGG Intronic
900309923 1:2028756-2028778 GGGCACAGCCAGGCTCTGGAAGG - Intronic
900351991 1:2239533-2239555 GGACACACCCTGGACCTGAATGG + Intronic
900390452 1:2431711-2431733 GGGCAGGGCCAGCAGCAGAAGGG - Intronic
900769580 1:4529808-4529830 GGGCACATTCAGGAGCTCACAGG + Intergenic
901363810 1:8728070-8728092 AGGAACTGCCAGGAGCTGAAAGG - Intronic
902360870 1:15941983-15942005 GGGGACATTCAGGAGCTGTAGGG + Exonic
902606262 1:17571048-17571070 GGGCAGAGCCTGGAGTTCAAGGG + Intronic
904186825 1:28711967-28711989 GGTCACAACCTGGGGCTGAATGG - Intronic
905223316 1:36463897-36463919 GGGCACAGAAAGGAACTGAGGGG - Intronic
905514670 1:38553609-38553631 GGGCTCACCCAGAAGCTGGAAGG - Intergenic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906195846 1:43930436-43930458 GGGCACAGCCAGGAGCCTGCTGG - Exonic
906350603 1:45055567-45055589 GGACACAGCCTGGAGCTCAGGGG + Intronic
907442751 1:54488969-54488991 GGACACAGCCATGATCTGAAGGG - Intergenic
910776628 1:90883042-90883064 GGGAAGAGCCAAGAGCTGTAGGG + Intergenic
912512984 1:110201076-110201098 GGGAACAGCAAGAAGCTGACTGG - Exonic
912949549 1:114111393-114111415 TGGCACAGCCAGGATGTGGACGG + Intronic
915086797 1:153394642-153394664 GGGCCCAGCTAGGTCCTGAAAGG + Intergenic
916143788 1:161722689-161722711 GGACTCACCCAGGAGCAGAAGGG - Exonic
916183287 1:162106241-162106263 TGGCCCATCCAGGAGCTGCACGG - Intronic
917010156 1:170462120-170462142 GGTTCCAGCCAGGAGCAGAAAGG + Intergenic
918041718 1:180917659-180917681 GGGCACAGCCATATGCTGAGAGG - Intronic
918474429 1:184908027-184908049 GGGCTCAGCCAGCAACTGGATGG + Intronic
919475949 1:198034219-198034241 GGGCAAAGACAGGAGCAGGAAGG + Intergenic
919802275 1:201361142-201361164 GGGCAGATGCAGGAGCTGAAGGG + Intronic
920049017 1:203152185-203152207 TGGCACAGCCTGGACCAGAATGG + Intronic
920847978 1:209609362-209609384 GGGCAGAGCCAGGTGGTGAGGGG + Intronic
921827837 1:219693751-219693773 GGGCACATGCAGGAGCCGACAGG - Intronic
922185391 1:223270004-223270026 GGGCACATCCAGGAGCTAGGAGG + Intronic
922567826 1:226612406-226612428 GGGCACAGACTGCAGATGAATGG + Intergenic
922665562 1:227465764-227465786 GGGCACAGGCAGCAGCAGAGAGG + Intergenic
923024675 1:230195157-230195179 GGGCACAGCCAGAACCCGAGAGG + Intronic
923044948 1:230348831-230348853 CGGCACAGCCTGAAACTGAAGGG + Intronic
923143619 1:231182595-231182617 GGGCACATCCAGCAGATGAATGG + Intronic
923658758 1:235940712-235940734 AGGCACAGCCAGGCATTGAAGGG - Intergenic
1063828103 10:9921412-9921434 GGCAAGATCCAGGAGCTGAAGGG - Intergenic
1064852769 10:19728538-19728560 GCATACAACCAGGAGCTGAAGGG - Intronic
1066094607 10:32060161-32060183 GGGGACAGGCAGGGGTTGAAAGG - Intergenic
1066116952 10:32248972-32248994 GGACACATCTAGGGGCTGAAAGG + Intergenic
1066258352 10:33703950-33703972 GGGCTGAGCCAGGAGGTGAGAGG - Intergenic
1066275674 10:33866078-33866100 GGACACCGCCAGAAGCTGGAGGG - Intergenic
1068335815 10:55631103-55631125 GGGCGAAGCCGGGAGCTGCAGGG + Intergenic
1068809299 10:61237986-61238008 GGGCACAACCAGGCGCGGTATGG - Intergenic
1069629645 10:69889839-69889861 GGGCACAGCCAGCACCCGGAAGG - Intronic
1070398362 10:76032217-76032239 GTGCCCACCCAGGAGCAGAAGGG + Intronic
1070797948 10:79228028-79228050 GGGCACAGACAGGATGGGAATGG - Intronic
1070858396 10:79628456-79628478 GGTCACATCCAGGATCTGAATGG + Intergenic
1070951308 10:80433460-80433482 TGGCCCAGCCAGGAGGAGAAAGG + Exonic
1072692130 10:97578659-97578681 GGGCTGACCCAGGAGCCGAACGG - Intronic
1072721225 10:97782120-97782142 GGGCACAGCCAGCTGCAGAGAGG - Intergenic
1072749597 10:97968206-97968228 GTGCACACCCAGGACCTTAAGGG - Intronic
1073059119 10:100722982-100723004 GGGCTCTTCCAGGAGCTGGATGG + Intergenic
1073320611 10:102614070-102614092 GCCAACAGCCAGGAGCTGCAGGG - Intronic
1074019873 10:109571313-109571335 GGGCAAAGCCAGGTTCAGAACGG + Intergenic
1074496566 10:113984632-113984654 GACCACAGCCTGGGGCTGAAAGG + Intergenic
1075826685 10:125363031-125363053 AGGCATAGCCATGAGCTGGAAGG - Intergenic
1076262197 10:129076045-129076067 GGGCCCAGGCATGAGCTGACGGG - Intergenic
1076358440 10:129869402-129869424 GAGCAAAGCCAGGAGCTGGCGGG - Intronic
1076568282 10:131413491-131413513 GGGAGCAGCCAGGAGCTGAGGGG + Intergenic
1077301359 11:1848631-1848653 GGGCACACGCAGGTGCTGGAGGG - Intergenic
1077351293 11:2094402-2094424 CGGCACAGCCCTGAGCTGGATGG + Intergenic
1077366365 11:2162890-2162912 GGGCAGAGCCAGGCGCTGGCAGG + Intergenic
1077396935 11:2329087-2329109 AGGCTCAGCCAGGAGCATAAGGG - Intergenic
1077404255 11:2375818-2375840 GGGGACAGCAGGGAGCTGATGGG + Intergenic
1077548724 11:3189552-3189574 GGGACCAGCCAGCAGCTGGAAGG - Intergenic
1078893555 11:15578692-15578714 AAGCTCAGCCAGGAGCTGGAGGG + Intergenic
1079393604 11:20043128-20043150 AGGGAGAGCCAGGAGCTGAGGGG - Intronic
1080783199 11:35449856-35449878 TGGCCCAGCCGGGAGCTGCATGG - Intronic
1081530668 11:43956918-43956940 GGGCACAGCAGTGAGGTGAATGG + Intergenic
1081597280 11:44467756-44467778 GGGCTATCCCAGGAGCTGAAAGG - Intergenic
1081685226 11:45037785-45037807 GGGCAAAGGCAGAAACTGAATGG - Intergenic
1082807209 11:57458802-57458824 GGGCACAGAGAGGAGCTGGGGGG + Intergenic
1083225424 11:61281646-61281668 GGGCGGGGCCAGGAGCTGAGAGG + Intronic
1083516479 11:63263460-63263482 GGGCCCACCCAGGAGTTGCATGG - Intronic
1084161993 11:67355113-67355135 GGGCACTGCATGGAGCTGGAGGG + Intronic
1084751221 11:71205435-71205457 GGGCACAGGCAGGAGCTGGAGGG - Intronic
1084964333 11:72736588-72736610 CAGCACAGCCAAGAGCTGAGGGG + Intronic
1085119109 11:73955920-73955942 GGGCACAGCCAGGACCCTTATGG + Intronic
1085324507 11:75596263-75596285 GGGCAAAGTCAGGACCTTAATGG + Intronic
1085512473 11:77095350-77095372 GGGCTCAGTCAGGGGCTGAAGGG + Intronic
1087010869 11:93512945-93512967 TGGCACATCTAGAAGCTGAAAGG + Intronic
1089793431 11:120960968-120960990 GGGCACATCCATGCGCTGCACGG - Exonic
1090321053 11:125844286-125844308 GGGCCCACCCAGGAGCTGCATGG + Intergenic
1090409578 11:126498610-126498632 TGTCACAGCCAGGAGGGGAAGGG + Intronic
1090758173 11:129813530-129813552 GGCCGCAGCCAGGAGCTGAGAGG - Intergenic
1091727917 12:2858411-2858433 TGTCCCTGCCAGGAGCTGAAGGG - Exonic
1091879524 12:3965637-3965659 AGGCACAGCCATGAGAGGAAAGG + Intergenic
1092147962 12:6227872-6227894 TGGCCCAGCCAGCAGCTGACAGG + Intronic
1092585744 12:9899452-9899474 GGGCACAGACTGAAGTTGAATGG + Intronic
1094185492 12:27638034-27638056 GGTGACTGCCAGGAGCTGAGGGG + Intronic
1096875884 12:54630141-54630163 AGACACAGCCATGAGCTGTAGGG + Intergenic
1097694277 12:62761842-62761864 TGACACAGCAAGGAGCTGGAAGG + Intronic
1099534632 12:83828595-83828617 GGGAACAGCCTGAAGATGAATGG + Intergenic
1100386874 12:94111925-94111947 GGGCACAGGCAAGAGCTGGAAGG + Intergenic
1100813809 12:98366185-98366207 GGGTACAGCAATCAGCTGAATGG + Intergenic
1103214388 12:119190213-119190235 GGGCAGAGCCAGGAGCTCCCAGG - Intronic
1103361675 12:120358485-120358507 GGGCACACCCAGGAGGAGACAGG - Intronic
1103621614 12:122190411-122190433 GGGCACAGCCAGGCGCAGGCTGG - Intronic
1104016461 12:124965355-124965377 GTGCCCAGCCAGGGGCTGAGTGG - Intronic
1104695738 12:130862357-130862379 GGGCTCAGCCAGGTGCAGAGAGG - Intergenic
1104760270 12:131293963-131293985 GAGCACAGCCAGGGGCTGGGCGG - Intergenic
1104921404 12:132292541-132292563 GGGCCCAGCCAGGACCAGGATGG - Intronic
1104939913 12:132390176-132390198 GGGCACAGCCATGGGCCGATGGG + Intergenic
1105014200 12:132776277-132776299 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105014250 12:132776512-132776534 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105014267 12:132776591-132776613 GGGCACAGGCGGGAGCAGCAGGG - Intronic
1105385344 13:19924184-19924206 GGTGATAACCAGGAGCTGAAGGG - Intergenic
1112064299 13:95776040-95776062 AGGCACAGCCAGGAGTTATAGGG - Intronic
1112166611 13:96926869-96926891 GGGCAAAGCTAGGAACTGAGTGG + Intergenic
1113729166 13:112627271-112627293 GGGCAGAACCGGGAGCAGAATGG - Intergenic
1113763695 13:112867691-112867713 GGACATAGCCAGGGGCTGGAGGG - Intronic
1113768884 13:112896142-112896164 AGGCACAGCCAGGTGCAGAGGGG + Intronic
1113921379 13:113914916-113914938 GAGCACAGCCAGGAGCAGGGTGG - Intergenic
1113931850 13:113972879-113972901 GGGCACAGCCAAGGGCGGGAGGG - Intergenic
1114485109 14:23057469-23057491 GGGCACAGCCCCGAGCCGATTGG + Exonic
1115828617 14:37309031-37309053 GAGCACAGCCACTAGTTGAAAGG - Intronic
1119562458 14:75602137-75602159 GAGCACATCCAGGTGCTGAGAGG - Intronic
1119851829 14:77871722-77871744 GGGGTCATGCAGGAGCTGAAGGG + Intronic
1122078233 14:99249151-99249173 TTGCCCAGCCAGGAGCAGAAAGG + Intronic
1122117420 14:99534870-99534892 GTGCACAGCCAAGCTCTGAATGG - Intronic
1122271323 14:100569544-100569566 GCTCACAGCCAGGAGGGGAAAGG - Intronic
1122906220 14:104802780-104802802 GGGCAGAGCCAGGTGCTGGTTGG - Exonic
1124244752 15:28059246-28059268 GGGAACATCCTGGAGCTGCAGGG + Intronic
1125036005 15:35124283-35124305 GGTCCCAACCAGGAACTGAAAGG + Intergenic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1125725828 15:41867692-41867714 GGGCACAGACTGCAGCTGGAGGG - Intronic
1125727145 15:41873918-41873940 GAGCAGTGCCAGGAGCTGGAAGG - Exonic
1126069623 15:44854542-44854564 GGGCAGCGGGAGGAGCTGAAGGG - Intergenic
1128033608 15:64503374-64503396 GGGAACAGGCAAGAGCTGGAAGG - Intronic
1129311833 15:74718243-74718265 CCACATAGCCAGGAGCTGAAGGG - Intergenic
1129314260 15:74731682-74731704 GGGCACAGGCAGGAGAGGAAGGG - Intergenic
1130984752 15:88837505-88837527 GGGTACAGCCAGGGGCTGCATGG - Intronic
1131082692 15:89550036-89550058 GGGCACAGCCAGGGACTTGAGGG + Intergenic
1131264288 15:90906541-90906563 AGGCACAGGCAGGGGCTGTAAGG + Intronic
1132543089 16:520477-520499 GAGCAGAACGAGGAGCTGAACGG + Exonic
1132806961 16:1779312-1779334 GGGGCCACCCAGGGGCTGAATGG + Intronic
1133237205 16:4392860-4392882 GGCCCCAGCCAGCAGCTGGAAGG + Intronic
1134414992 16:14035282-14035304 AGGCACAGCCAGGAGGTGGCAGG + Intergenic
1135031052 16:19039032-19039054 GGGCAGAGCCACAAGATGAACGG - Intronic
1138647868 16:58438347-58438369 GTGCACAGCCCTGAGCTGACGGG + Intergenic
1139466520 16:67156848-67156870 GTACAGAGCCAGGAGCTCAAGGG - Intronic
1140033030 16:71353691-71353713 AAGCAGATCCAGGAGCTGAAAGG + Intergenic
1141438540 16:84014619-84014641 GGGCAGAGCCAGGAGCAGAGTGG + Intronic
1141507657 16:84489361-84489383 AGCCACAGACAGGAGCTGAGAGG - Exonic
1141667465 16:85473318-85473340 GGGCAGGGCCAGGAGCTGGTGGG + Intergenic
1141774887 16:86116628-86116650 AGGCAGAGCCAGCAGCTGGAAGG + Intergenic
1141899900 16:86984383-86984405 GGGCAGAGCCAGGGTCTGAGCGG + Intergenic
1141929545 16:87192806-87192828 GGGCACAGCCAGGCACTGGAAGG + Intronic
1143006053 17:3835098-3835120 GAGTAGAGCTAGGAGCTGAAAGG + Intronic
1143282169 17:5763028-5763050 GTGCCCAGCCTGGAACTGAATGG - Intergenic
1143534040 17:7525053-7525075 GGGCACAGACTGAAGATGAATGG + Intergenic
1144431675 17:15198362-15198384 GGGCTTACCCAGGAGCTGCAAGG + Intergenic
1145060722 17:19731597-19731619 GACCACAGCCCAGAGCTGAAAGG - Intergenic
1146185102 17:30719626-30719648 GGGTCCAGCCAGGAGATGATGGG + Intergenic
1147384444 17:40073027-40073049 GGGCAGGGCCAGCAGCAGAACGG - Intronic
1147885295 17:43680165-43680187 GGGCACAGCCAGGAGGATGAGGG - Intergenic
1148201941 17:45755275-45755297 GTGCACAGGCAGCATCTGAATGG + Intergenic
1148329648 17:46806141-46806163 GGACCCAACCAGGAGCTGTAAGG - Intronic
1148750320 17:49941753-49941775 GGGCACAGCCACGGGCAGGATGG - Intergenic
1148889827 17:50799632-50799654 TGGCAGAGCCAGGAGCTGTGGGG + Intergenic
1149085606 17:52711564-52711586 GGGGCCAGAGAGGAGCTGAAAGG + Intergenic
1149696452 17:58620175-58620197 GGGCAGAGGCAGGAGATGAAGGG + Intronic
1152294114 17:79456738-79456760 GGGCAGAGGCAGGCTCTGAAGGG - Intronic
1152757356 17:82092564-82092586 GGCGACCCCCAGGAGCTGAATGG - Exonic
1152768849 17:82155455-82155477 AGGCACAGGAAGCAGCTGAAAGG - Intronic
1203169032 17_GL000205v2_random:130068-130090 GGGATCAATCAGGAGCTGAAGGG + Intergenic
1203174576 17_GL000205v2_random:185034-185056 GGGACCAATCAGGAGCTGAAGGG - Intergenic
1153679300 18:7485151-7485173 GGGGACAGCTAGGAGCTGGCAGG - Intergenic
1153800419 18:8663339-8663361 GGACACAGACAGGAGGTGCAAGG + Intergenic
1154083541 18:11280639-11280661 GGGGAAAGCCAGGAACCGAAAGG - Intergenic
1154161031 18:11981211-11981233 GGGCGCAGCCGGGAGCGGGAGGG + Intronic
1157594809 18:48858112-48858134 GGCCAAAGCCAGGCGCTAAAGGG - Intronic
1160151859 18:76401586-76401608 GGGCTCTGCCAGCAGCTGCAGGG - Intronic
1160209893 18:76868751-76868773 GAGCACCGCCAGGAGCTGGCTGG + Exonic
1160225694 18:77009201-77009223 GAGGACAGCCAGGAGGAGAAGGG - Intronic
1160504277 18:79418261-79418283 GGTCACAGTCAGGCGCTTAACGG + Intronic
1161035516 19:2082301-2082323 GGGCACTGCAAGGTGCTGAGCGG + Intronic
1161101613 19:2424541-2424563 GGGCTTAGCCTGGAGCTGGAGGG - Intronic
1161243756 19:3237466-3237488 GGGCAGTTCCTGGAGCTGAAGGG + Intronic
1161248053 19:3265638-3265660 GGGCAGTTCCTGGAGCTGAAGGG - Intronic
1161353834 19:3808483-3808505 GGGAACAGCCAGGAGCTCAGAGG - Intronic
1162387588 19:10369247-10369269 GGAGACAGCCAGGAGGTGACTGG - Intronic
1162973677 19:14196063-14196085 GGGTCCAGCCAGGAGATGATGGG - Intronic
1163124970 19:15239712-15239734 GGCCGCAGCGAGGGGCTGAAGGG + Exonic
1163210221 19:15834763-15834785 GGGCGCTGCCAGGAGCTTAAGGG - Intergenic
1163222368 19:15930794-15930816 GGGACCAGCCAGGACGTGAAAGG - Intronic
1163476527 19:17529364-17529386 TGGCAGAGCCATGAGATGAAAGG - Intronic
1163595018 19:18216200-18216222 GGGTACAGCCAGGATCTGCTGGG + Intronic
1163819018 19:19485582-19485604 GGGCTCAGGCAGAAGCTGCAAGG + Intronic
1164676925 19:30107205-30107227 GGGCGCAGCCAGGGGCTGAGTGG + Intergenic
1165307546 19:35011679-35011701 GGGCCCAGGGAGGAGCTGCAGGG - Intronic
1165739393 19:38196392-38196414 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1165739401 19:38196432-38196454 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1165739422 19:38196531-38196553 GGGCAGAGCAAGGAGGTCAAGGG + Intronic
1166364497 19:42271813-42271835 TGCCACTGCCAGGACCTGAAAGG - Intronic
1166454656 19:42930399-42930421 GGGGACAGGCAAGAGCTGATAGG + Intronic
1166544639 19:43626783-43626805 CGGGACCGCAAGGAGCTGAAAGG - Exonic
1166823527 19:45595394-45595416 GGGGAGAGCCAGGAGCTGCTGGG + Intronic
1167470409 19:49672559-49672581 GGGCACAGGGAGGAGGTGAGTGG + Intronic
1167620496 19:50557413-50557435 TGGCACAGCCAGGGACTGGACGG - Intronic
1168337003 19:55602617-55602639 GGGCACAGCGGGCAGCGGAAGGG - Exonic
1168429617 19:56267937-56267959 GCACACAGCCAGGAGGTGGAGGG + Intronic
925410085 2:3634930-3634952 GGGCACAGCAAGGCGGTGAGAGG - Intronic
926607244 2:14909781-14909803 GGGCACAGCGAGGTGCTAGAAGG + Intergenic
927312466 2:21646762-21646784 GGGCTCAACCAGCAGCTGATAGG - Intergenic
927515270 2:23668588-23668610 GGGAACAGATAGGAGCTGAGGGG + Intronic
928124633 2:28607041-28607063 GGGCAGAGCCCAGAGCTGTATGG + Intronic
928395612 2:30941301-30941323 GGAGACAGCCAGGAGCAAAATGG + Intronic
929276819 2:40034816-40034838 GGGCACAGCCATAGACTGAAAGG - Intergenic
929484059 2:42339267-42339289 TGGCACCACCAGGAGCTGAGGGG + Intronic
929923226 2:46188506-46188528 GGGCACAGACATGGGCTGCATGG - Intergenic
929971360 2:46580034-46580056 GGGCATAGACAGAAGCAGAAAGG - Intronic
931795121 2:65701074-65701096 GGGAAGAGCCAGTAGCTGCAAGG + Intergenic
931875713 2:66509550-66509572 GGTCACTGCCAGGGACTGAAGGG + Intronic
931935044 2:67187446-67187468 GGGAACAGCCACAAGCTGCAGGG - Intergenic
932604845 2:73158035-73158057 GGGGACAGCAGGGAGCTGATGGG + Intergenic
933084322 2:78036137-78036159 GGTCACAGCCAAGAGATGCAAGG + Intergenic
933660705 2:84925357-84925379 GGGAACAGCTAGTGGCTGAAGGG - Intergenic
934718272 2:96555475-96555497 GGGCACAGCCATGGGCTGGCAGG + Intergenic
934747258 2:96767540-96767562 AGGCACAGCTAGAAGCTGGAAGG - Intronic
934950153 2:98570588-98570610 GGACACACCCTGGAGCTGCAGGG + Intronic
934990227 2:98915307-98915329 AGGCAGTGCCAGGAGCTGACCGG + Intronic
936048025 2:109201735-109201757 GGGCACAGCCAAGCGGTGAAAGG + Intronic
936281562 2:111144902-111144924 AGGCACAGCCAGGGACTGCAGGG - Intronic
938108483 2:128549129-128549151 GGGCCCAGCCAGGAGCAGCGGGG - Intergenic
938926397 2:136047010-136047032 CAGCACAGTCAGGAGCAGAAAGG - Intergenic
939526105 2:143296305-143296327 TGGCACAGAGAAGAGCTGAAAGG + Intronic
940015658 2:149101525-149101547 GGCACCAGCCAAGAGCTGAAGGG + Intronic
940064420 2:149611211-149611233 AGGCACAGCTAGAAGATGAAGGG - Intergenic
940404715 2:153287579-153287601 GAGCCCCGCCAGCAGCTGAATGG - Intergenic
944750784 2:202707363-202707385 GGGCACATCTAGCAGATGAAGGG + Intronic
945403857 2:209422550-209422572 AGGCACACCCAGGAGCTGGGAGG - Intergenic
945511705 2:210711242-210711264 ATACACAGCCAGGAACTGAAAGG - Intergenic
945943563 2:215973068-215973090 GGGCACAGCCAGAGGATGATAGG + Intronic
947007228 2:225526148-225526170 GGGCACAGCCAGAATCCAAAAGG - Intronic
947010466 2:225560674-225560696 TGGCACAAGCAGGAGCTGGAAGG + Intronic
947670679 2:231933713-231933735 GGGCCTGGCCAGGACCTGAAGGG + Intergenic
947750770 2:232530791-232530813 GGGGCCAGGCAGGGGCTGAAGGG + Intronic
947871652 2:233442012-233442034 GAGCCCAGCCAGGAGCAGAGAGG + Intronic
947932503 2:233975365-233975387 CCCCACAGCCAGGAGCTCAAGGG + Intronic
948118492 2:235511395-235511417 GGGGGCAGCCAGGAGCCGCAGGG + Intronic
948649488 2:239431665-239431687 AGTCACAGACAGGAGCTGCAGGG - Intergenic
948860637 2:240751071-240751093 GGGCCCAGGGAGGTGCTGAATGG + Intronic
948867219 2:240782287-240782309 GGGCCCTGGGAGGAGCTGAAAGG - Intronic
948947821 2:241230075-241230097 AGGCCCAGCCAGGAGCTTCAGGG - Intronic
948993928 2:241569033-241569055 GGGCACTGGCAGTATCTGAATGG - Intronic
1169081365 20:2799471-2799493 GGGCAGAGCCTTGTGCTGAAGGG - Intronic
1170847514 20:19974860-19974882 GTGCACAGCCAGGACCTCAGTGG + Exonic
1170968873 20:21100957-21100979 GGGGACTGCGAGGAGCTGAAAGG - Intergenic
1171173683 20:23035820-23035842 CGGCACAGCACGGAGCCGAAGGG - Exonic
1172749178 20:37237815-37237837 GGGCCCAGGCAGGTGCTGCAAGG - Intronic
1173054672 20:39599544-39599566 GGGCAGATGGAGGAGCTGAACGG + Intergenic
1173667189 20:44771392-44771414 GGGGACAGCCGGAGGCTGAAGGG - Exonic
1174058342 20:47815100-47815122 GGGCAGAGACAGGAGCTGAGAGG + Intergenic
1174366860 20:50061682-50061704 GGGCCCAGGCAGGAGGTTAATGG + Intergenic
1175127799 20:56765293-56765315 GGGCACAGCCAGAAGGAAAAGGG + Intergenic
1175231422 20:57475841-57475863 GGCCACGGGGAGGAGCTGAATGG + Intergenic
1175380171 20:58557384-58557406 TGGAGCAGCCAGGAGCTGGAGGG + Intergenic
1176034004 20:63027633-63027655 AGGGACAGCAAGGAGCTGACAGG - Intergenic
1176227342 20:64008534-64008556 TGCCAAAGGCAGGAGCTGAAAGG - Intronic
1176332901 21:5565656-5565678 GGGACCAATCAGGAGCTGAAGGG - Intergenic
1176394856 21:6255296-6255318 GGGACCAATCAGGAGCTGAAGGG + Intergenic
1176442301 21:6733809-6733831 GGGACCAATCAGGAGCTGAAGGG - Intergenic
1176466563 21:7060878-7060900 GGGACCAATCAGGAGCTGAAGGG - Intronic
1176490124 21:7442656-7442678 GGGACCAATCAGGAGCTGAAGGG - Intergenic
1178619582 21:34161906-34161928 GGGCACAGACTGAAGATGAAGGG + Intergenic
1178684011 21:34697276-34697298 GGCCAAAGCCAGGAGGGGAAAGG + Intronic
1179118560 21:38520245-38520267 GGGAAGAGCCAGGAGCTGGAGGG + Intronic
1179348352 21:40583200-40583222 GGGCACAGCCAGCAACGCAAAGG + Intronic
1179521463 21:41948315-41948337 GGGCAGAGCCAGGGGCTGTCTGG - Intronic
1179533061 21:42033136-42033158 GGGCACAGCCAGGGGCAGGTGGG + Intergenic
1179724646 21:43335381-43335403 GCCCACAGCCAGGAGGTGGACGG - Intergenic
1179979831 21:44890151-44890173 CGGAGCAGCCAGGAGCTGGAAGG - Exonic
1180003074 21:45003879-45003901 GGGCACAGCCAGGACCCCCAGGG - Intergenic
1180071951 21:45441058-45441080 GGGCAGAGCTTGGAGCGGAAAGG - Intronic
1181305989 22:21917565-21917587 GAGCTCAGCCAGGAGCACAAGGG + Intergenic
1181593065 22:23896466-23896488 GGGGGCACCCAGGAGCTGAGGGG - Intronic
1181746276 22:24956937-24956959 GGCCACAGCCAGGAGCAGGCAGG - Intronic
1182296171 22:29312107-29312129 AGGCAGAGTCAGGAGCTGGAGGG - Intronic
1182343850 22:29645350-29645372 GGGCAAAGCTAAGAGCAGAAGGG + Intronic
1182357232 22:29727726-29727748 GGGCACAGCCATGCGCTCACTGG + Exonic
1183640018 22:39087082-39087104 GAGCACAGCCAAGACCTGAGTGG + Exonic
1184240167 22:43207672-43207694 GGGCAGAGGCTGGAGGTGAAAGG - Intronic
1184609377 22:45592849-45592871 GGGGCCAGCCATGAGCAGAAAGG - Intronic
1184784125 22:46663578-46663600 GGACACAGGCAGGAGATGAGGGG + Intronic
1184834973 22:47015750-47015772 GGTCTCAGCCAGGAGGAGAAGGG + Intronic
1185080782 22:48708348-48708370 GGGGACAGAGAGGAGCTGAAGGG - Intronic
951428423 3:22577032-22577054 TGGAACAGCCAGTAGCAGAATGG + Intergenic
952455150 3:33465747-33465769 GGGCACAGACTGAAGATGAATGG + Intergenic
952574459 3:34758660-34758682 GGGCCCAACCAGGAGCTGTATGG + Intergenic
952848579 3:37709551-37709573 GGGGAGAGCCAGGAGCTGAGTGG + Intronic
953410290 3:42687053-42687075 GGGCACAGTAAGGAGCAGCAAGG + Intronic
953586903 3:44209930-44209952 GGCCAGAGCCAGGAGCAGAATGG + Intergenic
953908694 3:46881546-46881568 AGGCCCGGCCAGCAGCTGAATGG + Intronic
954389287 3:50260409-50260431 CGGCACTGGCAGGAGATGAAAGG + Intergenic
954615455 3:51966971-51966993 GTGCCCAGCCAGGAGCTACAGGG + Intronic
955412677 3:58666252-58666274 GGGCACAAGAAGGAGCTGTAGGG - Intronic
956789240 3:72668152-72668174 GGGCAGAGCATGGACCTGAAGGG - Intergenic
957682805 3:83459517-83459539 GGGCACAGCCATGAGCCCAGAGG + Intergenic
960277311 3:115742606-115742628 CGGCCCATCCAGGAGCTGAATGG - Intergenic
961016802 3:123474736-123474758 GGGCACCCCCAGGAGCTTCAAGG - Intergenic
963052527 3:141154136-141154158 AGGCACAGACAGGAGATGAGAGG - Intergenic
967161577 3:186743751-186743773 GGGCAGAGCCAGCATCTGAGAGG + Intronic
968270172 3:197397459-197397481 GGGCAGAGCAAGAATCTGAACGG + Intergenic
968319514 3:197752260-197752282 TGGCAGAGGCAGGACCTGAAAGG - Intronic
968500599 4:948108-948130 GGTCACAGGCAGGATCTGAGGGG - Exonic
968600758 4:1508318-1508340 GGGGACAGCGAGGACCTGCAAGG - Intergenic
969040367 4:4290652-4290674 GGGCAAAGCCTGGAGATGAGAGG - Intronic
969608214 4:8212707-8212729 CCGCACAGCCAGCAGCTGCAGGG - Exonic
971642684 4:29156161-29156183 TGGCACAGGCAGAAGTTGAAAGG - Intergenic
974363249 4:60911258-60911280 AGTCACAGCCAAGAGATGAAAGG - Intergenic
975254506 4:72216938-72216960 AGGCACAGCCAGGACTTGCAGGG - Intergenic
976078017 4:81321348-81321370 GGGCCCACCCAGTAGCTGCATGG + Intergenic
976542708 4:86296368-86296390 GGGAGCACCCAGGAGATGAAAGG + Intronic
976898009 4:90135714-90135736 GGGCACAGCCAGGTAAGGAAAGG - Intronic
977573661 4:98655934-98655956 GGGCACAGAGAGGAGAGGAAGGG + Intronic
979052647 4:115953922-115953944 GGTCACACCCAGAAGCTGACTGG + Intergenic
979929254 4:126610353-126610375 GGGCACAGCTAAGAGATTAAGGG + Intergenic
982767864 4:159368651-159368673 GGCCACAGGCAGGGGCTGAAGGG + Intergenic
983010267 4:162537907-162537929 GGGCACAGTGAAGAGCTGAGGGG - Intergenic
983920051 4:173334859-173334881 GGGGACAGACAGGACCTAAATGG - Exonic
984413218 4:179423905-179423927 GGGCACTTCCATTAGCTGAATGG + Intergenic
985007233 4:185545961-185545983 GGGAAGAGCCAGGAGCTGTGAGG + Intergenic
985648284 5:1095398-1095420 AGGCACGGTGAGGAGCTGAAGGG + Intronic
986717149 5:10532976-10532998 GGCCACAGCCAGGAGCGCCAAGG + Intergenic
987481168 5:18459646-18459668 GAGCACAGGTAGGAGCTGATTGG - Intergenic
989657519 5:43760426-43760448 TGGCCCAGCCAGGAGCAGCATGG - Intergenic
992459071 5:76943536-76943558 GGGCACAGACAGGAACAGGAGGG - Intergenic
993090403 5:83418904-83418926 GGTCAATTCCAGGAGCTGAATGG - Intergenic
994191095 5:96870178-96870200 TCTGACAGCCAGGAGCTGAATGG + Intronic
994551462 5:101239768-101239790 GGGCACAACCAGGAGAAGCAAGG + Intergenic
995055511 5:107754514-107754536 GGGAGGAGCCAGGAGCAGAAAGG + Intergenic
995902175 5:117082871-117082893 GGGGACAGTTTGGAGCTGAAAGG + Intergenic
997296119 5:132769704-132769726 GAGCAAAGCCAGGATCTGAATGG + Intronic
997430985 5:133841096-133841118 GGACACAGCCAGGAATTGCAGGG - Intergenic
998733754 5:145111143-145111165 GGCCACAGCTAAGTGCTGAATGG + Intergenic
1000195744 5:158955843-158955865 AGGTTCAGCCAGCAGCTGAAAGG + Intronic
1000586092 5:163100744-163100766 AGGCACAACCAGGAGCAGAGGGG - Intergenic
1001678910 5:173541722-173541744 GGGCATGGCCAGGAGCAGGAAGG + Intergenic
1001697125 5:173679163-173679185 GGGCACAGCCAGGAGGGAAGCGG + Intergenic
1001762550 5:174220289-174220311 GGGGACTTGCAGGAGCTGAAGGG + Intronic
1002043743 5:176530983-176531005 GGGCACAGGCAGCTGCTGCATGG + Exonic
1002367256 5:178723242-178723264 GGGCCCAGCAAGGAGCTGCAGGG - Intronic
1002386235 5:178869241-178869263 GGGCCCAGCGAGGAGCTGCACGG + Intronic
1002424323 5:179166557-179166579 GGGAACAGCCAGGAGCTTAGGGG + Intronic
1002699037 5:181109708-181109730 GGGCAGAGGGAGGAGCTGAGCGG + Intergenic
1002782022 6:374237-374259 GGGCACAGCCAGGACCAGAGAGG + Intergenic
1002928057 6:1616421-1616443 GGAAACAGCCAGGAGCTTACAGG - Intergenic
1003095969 6:3143917-3143939 AGGCAAAGGCAGGAGCTGAGGGG - Intronic
1005910065 6:30301845-30301867 GGGCACAGTGAAGTGCTGAAGGG - Intergenic
1006370773 6:33642443-33642465 GGGCTCTGCCAGGACCGGAAGGG + Intronic
1006522607 6:34580495-34580517 GGGCACACTCAGGAGCTGCTGGG + Intergenic
1007130642 6:39470362-39470384 CGTCACAGGCAGGAGCTGCAAGG - Intronic
1007276231 6:40676148-40676170 GGGCACAGGCAGAGGTTGAAGGG - Intergenic
1007378651 6:41472664-41472686 GGGCTCAGCCAGGAAGTGCAGGG + Intergenic
1007649996 6:43413332-43413354 GGGGACAACCAGGAGCAGAGAGG + Intergenic
1007682045 6:43640842-43640864 GGACACAGCAAAGAGCAGAAAGG - Exonic
1010840276 6:80641691-80641713 TGGCACAGGCAGGCTCTGAATGG + Intergenic
1011587631 6:88943825-88943847 GGGCAGAGCAAGGAGGTTAAGGG - Intronic
1013343222 6:109235859-109235881 GGGCACAGACACGAGGTGGAAGG + Intergenic
1014339721 6:120188919-120188941 CGGCATAGCCTGGAGGTGAAAGG + Intergenic
1014577790 6:123094780-123094802 GAGCACAGACAGGAGCTGCTGGG - Intergenic
1014898201 6:126929641-126929663 GGTCAAGGCCAGGAGCTGAGAGG - Intergenic
1016590462 6:145737666-145737688 GGGCAGAGCCAGGGGCTAAAAGG + Intergenic
1016989141 6:149917489-149917511 ATGCAGAGACAGGAGCTGAAGGG - Intronic
1017580240 6:155856983-155857005 GGGCATGGGGAGGAGCTGAAGGG - Intergenic
1017628324 6:156370639-156370661 GGGGACAGCCAGGCTCTGGAGGG - Intergenic
1018824304 6:167397742-167397764 AGGCACACCCTGGAGCTCAAGGG - Intergenic
1018943667 6:168329385-168329407 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018943693 6:168329488-168329510 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018943714 6:168329569-168329591 GGGCACAGCATGGAGGTGAGAGG - Intergenic
1018943718 6:168329590-168329612 GGGCACAGCATGGAGGTGATAGG - Intergenic
1018943756 6:168329754-168329776 GGGCACAGCATGGAGCTGAGAGG - Intergenic
1019493173 7:1324471-1324493 GGGCACAGGCAGGGGCTGGGAGG + Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1019612815 7:1945573-1945595 GGGCCCACCCTGGAGATGAAGGG + Intronic
1020118237 7:5488242-5488264 GGCCACAGGCAGCAGGTGAATGG + Intronic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1020330669 7:7013768-7013790 GAACACAGCCAGGGGCTGAGAGG + Intergenic
1022113742 7:27246096-27246118 GGGCGCAGCGAGCCGCTGAAGGG - Exonic
1023218095 7:37886820-37886842 GGGAACAGCCAAGGGCAGAATGG + Intronic
1023996902 7:45164143-45164165 GGGCACAGGCAGGAGCACAGTGG - Intronic
1024257800 7:47551332-47551354 GGGCACAGCCATGGACTGGATGG + Intronic
1024259481 7:47563156-47563178 GGTCACAGCCAGGAGCTGCATGG + Intronic
1024485907 7:49919122-49919144 GGGCACAGTCAGGACTGGAATGG + Exonic
1025033108 7:55572826-55572848 GGGGAGAGCCAGGAGCGGAGCGG - Intronic
1026104978 7:67413717-67413739 GGGCAGAGACAGAAGTTGAATGG + Intergenic
1026928046 7:74207346-74207368 GTGCACAGTCTGGGGCTGAAGGG + Intronic
1027878259 7:83799689-83799711 GGGCACAGGCAGAAGATGGATGG + Intergenic
1029180007 7:98693560-98693582 AGACACAGCCAGGAGCTGTGTGG - Intergenic
1029211268 7:98910175-98910197 GAGCAGGGCCAGGAGCTGCAGGG - Exonic
1029670087 7:102024152-102024174 GGGCAAGGCCAGGCCCTGAATGG - Intronic
1033204448 7:139405696-139405718 TGGAACAACTAGGAGCTGAAGGG + Exonic
1035046777 7:155973084-155973106 TGCCACTGCCTGGAGCTGAAAGG - Intergenic
1035068015 7:156122067-156122089 GGGCTCAGGCAGTAGCTGAGGGG + Intergenic
1036293750 8:7518212-7518234 GGGCAAAGCCAGGAGGAGGAAGG + Intergenic
1036328811 8:7802783-7802805 GGGCAAAGCCAGGAGGAGGAAGG - Intergenic
1037277774 8:17200095-17200117 GGGCACTGACAGCAGCTGCAGGG - Intronic
1037390569 8:18387467-18387489 AGGAACAGGCAGGAGCTGAAGGG - Intergenic
1037752799 8:21693582-21693604 TGGCCCAGGCAGGAGCAGAAGGG + Intronic
1037763463 8:21757145-21757167 GAGCACAGCCAGCAGCAGAGGGG + Intronic
1037822630 8:22142267-22142289 AGGCTCAGTCAGGAGCTGGAAGG + Intergenic
1037966514 8:23138240-23138262 AGGAACAGGCAGAAGCTGAAGGG - Exonic
1038452930 8:27651448-27651470 GGGCCCAGGTTGGAGCTGAAGGG - Intronic
1045551217 8:103174361-103174383 GGGCACAGCCAGGGGCCTGATGG + Intronic
1045682613 8:104678986-104679008 GGCCACTGCCAGGAATTGAATGG + Intronic
1046663707 8:116976636-116976658 GGGCAAAGCCAGGAGCGCAGAGG + Intronic
1048380920 8:133864107-133864129 GGCCACACCCATGAACTGAATGG + Intergenic
1048496336 8:134939131-134939153 CTGCACAGCTGGGAGCTGAAGGG + Intergenic
1049553839 8:143272651-143272673 GGGCACAGCCAGCAGGTGGCAGG + Intronic
1049766939 8:144359275-144359297 GGGCCCAGCCTTGGGCTGAATGG + Exonic
1050821128 9:9881621-9881643 GGGCATAGCAAAGAGCTGGAGGG + Intronic
1051585603 9:18723661-18723683 GGGCACAGCCAGGAGTTTCTTGG + Intronic
1052538977 9:29782099-29782121 GAGCACAGCCAGAAACTGGAAGG - Intergenic
1052895908 9:33748327-33748349 GGCCGCAGCCAGGAGCTGGGAGG - Intergenic
1053554081 9:39116310-39116332 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1053818184 9:41936435-41936457 CTGAACAGCCAGGAGCTGGAGGG + Intronic
1054108443 9:61080094-61080116 CTGAACAGCCAGGAGCTGGAGGG + Intergenic
1054612414 9:67251031-67251053 CTGAACAGCCAGGAGCTGGAGGG - Intergenic
1057214507 9:93220523-93220545 CAGCCCAGCCAGGAGCTGATGGG + Intronic
1057266881 9:93623048-93623070 GGGCACAGCCTGGAGCAGCCAGG + Intronic
1057828875 9:98392143-98392165 GGGCAGAGCCCGGGGCTGAAAGG + Intronic
1059510105 9:114837011-114837033 TGGCCCACCCAGGAGCTGCATGG - Intergenic
1060247429 9:121958175-121958197 GGGCACAACTAAGACCTGAATGG + Intronic
1060745249 9:126126940-126126962 GCTCAGAGCCAGCAGCTGAATGG - Intergenic
1060889628 9:127179722-127179744 GGGTACACTGAGGAGCTGAAAGG + Intronic
1061327090 9:129870390-129870412 GGGCAAGAACAGGAGCTGAAGGG - Intronic
1061410076 9:130415798-130415820 GGACCCAGCCAGCAACTGAACGG - Intronic
1061588548 9:131583770-131583792 GTGCACAGCCAGGAGCAGGTGGG - Intronic
1061881748 9:133572341-133572363 GGGCAGAGCCAGGGCCTGAAGGG + Intronic
1062562124 9:137146329-137146351 GGGCCCAGCCAGGAGGGGACAGG - Intronic
1203429186 Un_GL000195v1:74627-74649 GGGACCAATCAGGAGCTGAAGGG + Intergenic
1203437102 Un_GL000195v1:148625-148647 GGGATCAATCAGGAGCTGAAGGG - Intergenic
1203745712 Un_GL000218v1:39815-39837 GGTCACAGCGAGGAGGTGGACGG + Intergenic
1203564400 Un_KI270744v1:79665-79687 GGTCACAGCGAGGAGGTGGACGG - Intergenic
1187715817 X:22101583-22101605 GGGCAGAGCCATAAGATGAAAGG - Intronic
1188803596 X:34560392-34560414 GGGCACAGACTGAAGATGAATGG + Intergenic
1189265717 X:39714672-39714694 GGGCACAGCCCAGAGCTCCACGG + Intergenic
1190554263 X:51618072-51618094 GGGGACAGGCAGGGGCTGACTGG + Intergenic
1190560558 X:51682030-51682052 GGGGACAGGCAGGGGCTGACTGG + Intergenic
1190563733 X:51711291-51711313 GGGGACAGGCAGGGGCTGACTGG - Intergenic
1192174207 X:68875682-68875704 GGGCTCAGCCAGGAGGAGAGTGG + Intergenic
1192210978 X:69127525-69127547 GGGCAATGCCAGGAGGTGCATGG + Intergenic
1195803241 X:108735590-108735612 GGGCACAGAAAAGAGCTGAGCGG - Exonic
1196735388 X:118977012-118977034 GTGCACAGACAGGAGCTAGAAGG - Intronic
1197819322 X:130529558-130529580 GGCCACTGCCAAGGGCTGAAAGG - Intergenic
1198006385 X:132498700-132498722 GGGCAAAGCCAGGGGCTGCACGG + Intergenic
1198092607 X:133346408-133346430 GGGCACATCAAGGAGCTGAACGG + Intronic