ID: 1020129688

View in Genome Browser
Species Human (GRCh38)
Location 7:5552799-5552821
Sequence GCTTACGTGCCCGGGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020129680_1020129688 17 Left 1020129680 7:5552759-5552781 CCGCAGCTCCCGTGTTAGTAAAA 0: 1
1: 0
2: 1
3: 20
4: 172
Right 1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG No data
1020129679_1020129688 18 Left 1020129679 7:5552758-5552780 CCCGCAGCTCCCGTGTTAGTAAA 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG No data
1020129678_1020129688 27 Left 1020129678 7:5552749-5552771 CCAGCGCTGCCCGCAGCTCCCGT 0: 1
1: 0
2: 1
3: 26
4: 260
Right 1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG No data
1020129681_1020129688 9 Left 1020129681 7:5552767-5552789 CCCGTGTTAGTAAAACGTTAGCT 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG No data
1020129682_1020129688 8 Left 1020129682 7:5552768-5552790 CCGTGTTAGTAAAACGTTAGCTG 0: 1
1: 0
2: 0
3: 6
4: 122
Right 1020129688 7:5552799-5552821 GCTTACGTGCCCGGGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020129688 Original CRISPR GCTTACGTGCCCGGGGAGGG AGG Intronic
No off target data available for this crispr