ID: 1020134368

View in Genome Browser
Species Human (GRCh38)
Location 7:5578559-5578581
Sequence TTCACTGAATTTCAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020134364_1020134368 16 Left 1020134364 7:5578520-5578542 CCCGATGAGTCAAACTGTGTTCC No data
Right 1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG No data
1020134367_1020134368 -5 Left 1020134367 7:5578541-5578563 CCGCGGTTAACTGAGTATTTCAC No data
Right 1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG No data
1020134365_1020134368 15 Left 1020134365 7:5578521-5578543 CCGATGAGTCAAACTGTGTTCCG No data
Right 1020134368 7:5578559-5578581 TTCACTGAATTTCAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020134368 Original CRISPR TTCACTGAATTTCAAAGAAC TGG Intergenic
No off target data available for this crispr