ID: 1020134746

View in Genome Browser
Species Human (GRCh38)
Location 7:5580936-5580958
Sequence GGCCCACGTGGTTTTCAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020134737_1020134746 11 Left 1020134737 7:5580902-5580924 CCAGCAAGGTCAGCACCCAGGTC No data
Right 1020134746 7:5580936-5580958 GGCCCACGTGGTTTTCAGTCTGG No data
1020134741_1020134746 -5 Left 1020134741 7:5580918-5580940 CCAGGTCTCCCGCACCTGGGCCC No data
Right 1020134746 7:5580936-5580958 GGCCCACGTGGTTTTCAGTCTGG No data
1020134740_1020134746 -4 Left 1020134740 7:5580917-5580939 CCCAGGTCTCCCGCACCTGGGCC No data
Right 1020134746 7:5580936-5580958 GGCCCACGTGGTTTTCAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020134746 Original CRISPR GGCCCACGTGGTTTTCAGTC TGG Intergenic
No off target data available for this crispr