ID: 1020136598

View in Genome Browser
Species Human (GRCh38)
Location 7:5591610-5591632
Sequence TAAACTGGGATTGCTGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020136598_1020136605 -5 Left 1020136598 7:5591610-5591632 CCAGCCCCAGCAATCCCAGTTTA No data
Right 1020136605 7:5591628-5591650 GTTTATCAGCGAGCCGGCTGAGG No data
1020136598_1020136606 -4 Left 1020136598 7:5591610-5591632 CCAGCCCCAGCAATCCCAGTTTA No data
Right 1020136606 7:5591629-5591651 TTTATCAGCGAGCCGGCTGAGGG No data
1020136598_1020136610 19 Left 1020136598 7:5591610-5591632 CCAGCCCCAGCAATCCCAGTTTA No data
Right 1020136610 7:5591652-5591674 CCCGGAGTTATCTCAGTGCCCGG No data
1020136598_1020136607 1 Left 1020136598 7:5591610-5591632 CCAGCCCCAGCAATCCCAGTTTA No data
Right 1020136607 7:5591634-5591656 CAGCGAGCCGGCTGAGGGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020136598 Original CRISPR TAAACTGGGATTGCTGGGGC TGG (reversed) Intergenic
No off target data available for this crispr