ID: 1020136836

View in Genome Browser
Species Human (GRCh38)
Location 7:5592534-5592556
Sequence GGTCGGGGTGTCCGAGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020136821_1020136836 16 Left 1020136821 7:5592495-5592517 CCTCAAACCTCGCTCGTCCTTGC No data
Right 1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG No data
1020136822_1020136836 9 Left 1020136822 7:5592502-5592524 CCTCGCTCGTCCTTGCTCCTAGC No data
Right 1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG No data
1020136825_1020136836 -1 Left 1020136825 7:5592512-5592534 CCTTGCTCCTAGCGAGGCTTGGG No data
Right 1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG No data
1020136820_1020136836 25 Left 1020136820 7:5592486-5592508 CCATCGTGACCTCAAACCTCGCT No data
Right 1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG No data
1020136830_1020136836 -8 Left 1020136830 7:5592519-5592541 CCTAGCGAGGCTTGGGGTCGGGG No data
Right 1020136836 7:5592534-5592556 GGTCGGGGTGTCCGAGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020136836 Original CRISPR GGTCGGGGTGTCCGAGGTGG GGG Intergenic