ID: 1020137065

View in Genome Browser
Species Human (GRCh38)
Location 7:5593539-5593561
Sequence CCTGGTGGCGCGCCCCGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020137054_1020137065 11 Left 1020137054 7:5593505-5593527 CCGCCGACCACCGCTTCCTGCGC 0: 1
1: 1
2: 0
3: 12
4: 219
Right 1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG 0: 2
1: 0
2: 0
3: 17
4: 101
1020137060_1020137065 -5 Left 1020137060 7:5593521-5593543 CCTGCGCCACGACGGGCGCCTGG 0: 1
1: 0
2: 1
3: 7
4: 113
Right 1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG 0: 2
1: 0
2: 0
3: 17
4: 101
1020137055_1020137065 8 Left 1020137055 7:5593508-5593530 CCGACCACCGCTTCCTGCGCCAC 0: 1
1: 0
2: 0
3: 17
4: 228
Right 1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG 0: 2
1: 0
2: 0
3: 17
4: 101
1020137056_1020137065 4 Left 1020137056 7:5593512-5593534 CCACCGCTTCCTGCGCCACGACG 0: 1
1: 0
2: 1
3: 3
4: 96
Right 1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG 0: 2
1: 0
2: 0
3: 17
4: 101
1020137059_1020137065 1 Left 1020137059 7:5593515-5593537 CCGCTTCCTGCGCCACGACGGGC 0: 1
1: 0
2: 2
3: 5
4: 107
Right 1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG 0: 2
1: 0
2: 0
3: 17
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020137065 Original CRISPR CCTGGTGGCGCGCCCCGAGC CGG Exonic
900199859 1:1399594-1399616 CCTGCCTGTGCGCCCCGAGCGGG + Exonic
900255047 1:1693486-1693508 GCTGGTGGCGCGCTCCGGGGCGG + Intronic
900263790 1:1746752-1746774 GCTGGTGGCGCGCTCCGGGGCGG + Intergenic
901448075 1:9320073-9320095 CCTGGCGGCCTGCCCTGAGCAGG - Intronic
901881515 1:12196791-12196813 CCTGGTGGCGTGCGTAGAGCAGG + Intronic
904376672 1:30086151-30086173 CCTGGTGGGGCGCCCCGCACCGG - Intergenic
905476497 1:38232385-38232407 CCTGCTAGCTCGCCCCCAGCTGG - Intergenic
906038513 1:42767594-42767616 CCTCGTGGCGCTCGCAGAGCAGG + Exonic
908195377 1:61742400-61742422 CCCGGTGCCCCGCCCCGGGCGGG + Intergenic
912174818 1:107141689-107141711 CCCGGGGGTGCGCCCCGGGCCGG + Intronic
915168601 1:153962667-153962689 CCTGGTGTGGCGCCCCGAGGCGG - Exonic
1063393623 10:5666400-5666422 GGTGGTGGCGCGCCCCGCGCTGG - Intronic
1065637503 10:27745852-27745874 CCGGGCGGCGCGCGCCGGGCTGG - Exonic
1066141847 10:32511812-32511834 GCTGGTGGCGCGGGCAGAGCTGG - Intronic
1066464430 10:35640418-35640440 CCTGGTGGCGGGCCACGAGAAGG - Exonic
1072070266 10:91908702-91908724 ACTGGTGGCGCGCCCCGTCCGGG + Exonic
1076116824 10:127906977-127906999 CCTGGATGCGCTCCCCGCGCCGG + Intergenic
1077041836 11:528263-528285 GCTGGTGGCGAGTCCTGAGCAGG + Intergenic
1077554162 11:3217982-3218004 CCTGGGGGAGGGCGCCGAGCTGG - Exonic
1081625294 11:44651859-44651881 CCTGGTGGCTCCCCTAGAGCTGG + Intergenic
1083618031 11:64035990-64036012 CACGGTGGCGGGCCCGGAGCGGG - Intronic
1084066034 11:66704950-66704972 CCTGGTGTCCAGCCCCGAGCTGG - Exonic
1084590635 11:70088048-70088070 CCTGGAGGCGGGCCTGGAGCTGG + Exonic
1084654160 11:70505572-70505594 ACTGGGGGCCCGCCCAGAGCAGG - Intronic
1091250715 11:134141680-134141702 GCTGGTGGGGGGCCCCAAGCTGG + Intronic
1092254629 12:6919720-6919742 CCTGGTAGAGTGCCCCCAGCTGG - Exonic
1098973539 12:76879161-76879183 CCTGGTGGCTAGCCCGGAGCGGG - Intergenic
1101439704 12:104694401-104694423 CCTGGTGCAGCGCCCAGTGCAGG - Intronic
1104602432 12:130162598-130162620 CCAGGTGGCGCGTCTGGAGCGGG - Exonic
1104887467 12:132119087-132119109 CCTGGTGGCGAGCGCCGGCCTGG - Intronic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1111337412 13:86840929-86840951 CCTGGAGGCGCCCCTCAAGCAGG - Intergenic
1114629082 14:24147728-24147750 CCTGGTGGCCCGCGAGGAGCTGG + Exonic
1118030452 14:61812979-61813001 CCTGGCGGCGCGCCCCGCGAGGG + Intergenic
1118312793 14:64705539-64705561 CCTGCTGGGGCCCCCAGAGCAGG - Intronic
1122130705 14:99603367-99603389 TCGGGTGGCGCGCCCGGCGCGGG - Exonic
1122736978 14:103848464-103848486 CCATGTGGGGGGCCCCGAGCGGG - Intergenic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1125604206 15:40930800-40930822 CCTGGAGCTGCGCCCCGCGCTGG + Intronic
1129189152 15:73927467-73927489 CCTCGTAGCGCGCCCGGGGCTGG - Exonic
1129968234 15:79755809-79755831 CCTGGTGCCTCCCCCCGACCAGG - Intergenic
1130044325 15:80431859-80431881 CCTGGTGGAGAGCACCCAGCAGG + Intronic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1132875662 16:2135829-2135851 CCTGGCCCCGAGCCCCGAGCGGG - Exonic
1134519323 16:14911524-14911546 CCTGGCCCCGAGCCCCGAGCGGG + Intronic
1134706993 16:16310179-16310201 CCTGGCCCCGAGCCCCGAGCGGG + Intergenic
1134960547 16:18401945-18401967 CCTGGCCCCGAGCCCCGAGCGGG - Intergenic
1140479580 16:75255286-75255308 CCTGCTGCCGCTCCCAGAGCTGG - Intronic
1141663447 16:85453785-85453807 CCTGGGGGTCCGCCCAGAGCTGG - Intergenic
1141987643 16:87590215-87590237 CCTGGTCGTGCCTCCCGAGCGGG + Intergenic
1142236850 16:88926493-88926515 CCTGGTGACTGGCCCCGAGCAGG - Intronic
1142762487 17:2050444-2050466 CCTGGTCGCGAGCGCCGGGCGGG - Intergenic
1147232135 17:39027283-39027305 GCTGGCGCCGCGCCCTGAGCCGG - Intergenic
1147317320 17:39627189-39627211 CCTGGGGGCGCGCCCAGCCCGGG + Exonic
1149654327 17:58302370-58302392 CCTGGGGGCGCTGCCAGAGCTGG + Exonic
1151337875 17:73450763-73450785 GTTAGTGGCGCTCCCCGAGCTGG - Intronic
1152566740 17:81103687-81103709 CCTGCCGGTGCCCCCCGAGCTGG + Exonic
1154025573 18:10704540-10704562 CCTGGTGGCCCGCTCGGAGATGG - Exonic
1155507524 18:26548041-26548063 CGTGCTGCAGCGCCCCGAGCGGG - Intronic
1157498282 18:48171678-48171700 CCTGGAGGCTGGCCCAGAGCAGG + Intronic
1160968729 19:1758023-1758045 ACGCGTGGCCCGCCCCGAGCCGG - Intronic
1161029594 19:2051478-2051500 CCCTGCGGCGCGCCCGGAGCTGG + Intergenic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161854013 19:6753504-6753526 CCATGTGACGCGCCCCGTGCAGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1165357215 19:35311709-35311731 CCAGGTGGCTCGTCCCCAGCCGG + Intronic
1166538729 19:43592229-43592251 CCCGGTGACGCGCGCCGAGGTGG - Exonic
1166997478 19:46726641-46726663 CCTGGTGCCGCTCACCCAGCAGG + Intronic
1168092707 19:54096112-54096134 GCTGGTGGCGCTGCCCGGGCCGG - Exonic
935217742 2:100988180-100988202 GTTGGGGGCCCGCCCCGAGCTGG - Exonic
941812636 2:169768918-169768940 TCTGGCGGCGCGCCCCGACCCGG + Intronic
944104769 2:196068448-196068470 CCTGCTGGCGCGCCGCTAGGCGG + Intronic
946246001 2:218387802-218387824 TGTGGTGGCGCGTCCTGAGCAGG + Exonic
1173576649 20:44116309-44116331 CCTGCTGGAGCCCCCCGACCGGG - Exonic
1175835131 20:61988955-61988977 CCTGGCGCCGCGACCCCAGCAGG + Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181060009 22:20277931-20277953 ACTGCTGGTGCGCCCTGAGCGGG - Intronic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181365368 22:22372381-22372403 CCTGGAGGCCCGCCCTGAGAAGG - Intergenic
1181793048 22:25282798-25282820 GCTGGTGGGGCGCGCCGAGCAGG + Intergenic
1182623617 22:31630837-31630859 CCTAGGGGCGCTCCCGGAGCCGG + Intronic
1183188512 22:36306382-36306404 CCTGGTGGGGTGGCCCGGGCAGG - Intronic
1183683693 22:39349964-39349986 GCCGGCGGCGCGCGCCGAGCGGG + Intronic
1183739603 22:39662499-39662521 CCAGGAGGCGGGGCCCGAGCGGG + Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
956823289 3:72973203-72973225 CCTGGTGCCCCTCCCCCAGCTGG - Intronic
961377294 3:126475535-126475557 CCTGGCGAGCCGCCCCGAGCAGG - Exonic
963061741 3:141231847-141231869 GCTGGCGGCGAGCGCCGAGCCGG + Exonic
964383368 3:156120770-156120792 CCAGTTGACGCGCCCTGAGCTGG - Exonic
966721240 3:183064527-183064549 GCTGGTGGCGTGCCATGAGCAGG - Intronic
969858625 4:10019101-10019123 CCTGGCTGCGCGCCCGGTGCCGG - Intronic
970194532 4:13541896-13541918 CTTGGCGGGGCGCCCCGTGCAGG + Exonic
972594207 4:40516018-40516040 CCTGTTGCCACGCCCCGGGCAGG - Intronic
982435167 4:155376782-155376804 CCTGGCGGCGCCCGCAGAGCCGG + Exonic
986608361 5:9545216-9545238 CCTGGAGGCGCGCCGGGGGCGGG + Intronic
986721147 5:10562807-10562829 CCTGCTGGCGGCCCCCGACCCGG - Intergenic
992052833 5:72956438-72956460 CCCGGTGCCGCGCTCCGCGCGGG + Intronic
992400046 5:76403505-76403527 GCGGGGGGCGCGCCCCGGGCGGG + Exonic
1001577087 5:172771435-172771457 CCTGGGGACGCGCCAAGAGCAGG - Intergenic
1002093290 5:176817167-176817189 ACTGGTGGGGCCCCCAGAGCCGG + Intronic
1003868675 6:10384852-10384874 CCTCGAGGCGCGCGCCGGGCCGG + Intergenic
1014570891 6:123006156-123006178 GCTGGTGGCGGGCCCAGAGGAGG + Intronic
1018734768 6:166679633-166679655 CCTGGCGGCGCTCCTCGATCTGG + Intronic
1020094908 7:5362790-5362812 CCTGGTGGCGCGGCCCTCCCTGG - Exonic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1024527774 7:50363223-50363245 CCTGGTGGAGCCCCCAGACCAGG + Intronic
1029104989 7:98167770-98167792 CCTGGGGGCGCTCCCCGACCAGG - Intronic
1031406363 7:121392104-121392126 CCTGGTGGAGCTCCCAGATCTGG + Intronic
1032115230 7:129111121-129111143 CCTGGTGGCCTGCCCCTACCTGG + Intergenic
1037811419 8:22089262-22089284 CCTGCAGCAGCGCCCCGAGCCGG - Exonic
1041449834 8:57994764-57994786 CCTGGCGGTGCGGCCCGAGCCGG - Exonic
1051079628 9:13279400-13279422 CCTGGGCGGGCGCCGCGAGCCGG - Exonic
1056711008 9:88991708-88991730 CCTGGTTCCGCGCCCCGCCCGGG - Intronic
1060014831 9:120078193-120078215 CCTGGTGCCGGGCCCACAGCAGG - Intergenic
1060209121 9:121699539-121699561 CCGTGTGGCTCGCCCCGGGCCGG - Intronic
1062254955 9:135616489-135616511 CCTGGTGGAGAGCCCTGAGAGGG + Intergenic
1062733508 9:138121836-138121858 CCTGGAGGAGCGGCCCGAGTTGG - Exonic
1187698235 X:21941309-21941331 GCTGGGGGCGTGCGCCGAGCGGG + Intronic