ID: 1020137212

View in Genome Browser
Species Human (GRCh38)
Location 7:5594073-5594095
Sequence CCCCACGCGCGCTGATCCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020137210_1020137212 -9 Left 1020137210 7:5594059-5594081 CCAATCTTGGCTCTCCCCACGCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137208_1020137212 -5 Left 1020137208 7:5594055-5594077 CCGCCCAATCTTGGCTCTCCCCA 0: 1
1: 0
2: 2
3: 19
4: 273
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137196_1020137212 12 Left 1020137196 7:5594038-5594060 CCTCCTAACCCCCCCCCCCGCCC 0: 1
1: 3
2: 38
3: 355
4: 3208
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137204_1020137212 -1 Left 1020137204 7:5594051-5594073 CCCCCCGCCCAATCTTGGCTCTC 0: 1
1: 0
2: 1
3: 17
4: 174
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137198_1020137212 4 Left 1020137198 7:5594046-5594068 CCCCCCCCCCCGCCCAATCTTGG 0: 1
1: 0
2: 4
3: 38
4: 524
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137201_1020137212 2 Left 1020137201 7:5594048-5594070 CCCCCCCCCGCCCAATCTTGGCT 0: 1
1: 0
2: 1
3: 28
4: 327
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137194_1020137212 24 Left 1020137194 7:5594026-5594048 CCGTACGTGCACCCTCCTAACCC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137209_1020137212 -8 Left 1020137209 7:5594058-5594080 CCCAATCTTGGCTCTCCCCACGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137203_1020137212 0 Left 1020137203 7:5594050-5594072 CCCCCCCGCCCAATCTTGGCTCT 0: 1
1: 1
2: 0
3: 19
4: 211
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137207_1020137212 -4 Left 1020137207 7:5594054-5594076 CCCGCCCAATCTTGGCTCTCCCC 0: 1
1: 0
2: 1
3: 24
4: 244
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137197_1020137212 9 Left 1020137197 7:5594041-5594063 CCTAACCCCCCCCCCCGCCCAAT 0: 1
1: 2
2: 10
3: 108
4: 1049
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137205_1020137212 -2 Left 1020137205 7:5594052-5594074 CCCCCGCCCAATCTTGGCTCTCC 0: 1
1: 0
2: 1
3: 6
4: 201
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137195_1020137212 13 Left 1020137195 7:5594037-5594059 CCCTCCTAACCCCCCCCCCCGCC 0: 1
1: 1
2: 13
3: 154
4: 1425
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137202_1020137212 1 Left 1020137202 7:5594049-5594071 CCCCCCCCGCCCAATCTTGGCTC 0: 1
1: 1
2: 0
3: 26
4: 246
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137200_1020137212 3 Left 1020137200 7:5594047-5594069 CCCCCCCCCCGCCCAATCTTGGC 0: 1
1: 0
2: 3
3: 23
4: 355
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data
1020137206_1020137212 -3 Left 1020137206 7:5594053-5594075 CCCCGCCCAATCTTGGCTCTCCC 0: 1
1: 0
2: 2
3: 22
4: 189
Right 1020137212 7:5594073-5594095 CCCCACGCGCGCTGATCCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020137212 Original CRISPR CCCCACGCGCGCTGATCCCT CGG Intronic
No off target data available for this crispr