ID: 1020140169

View in Genome Browser
Species Human (GRCh38)
Location 7:5607511-5607533
Sequence GTGCGCTGGGAAGGCGGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020140162_1020140169 9 Left 1020140162 7:5607479-5607501 CCTGGAGCGGAGGGACCTGGCGT No data
Right 1020140169 7:5607511-5607533 GTGCGCTGGGAAGGCGGTGATGG No data
1020140163_1020140169 -6 Left 1020140163 7:5607494-5607516 CCTGGCGTCCAGTCATTGTGCGC No data
Right 1020140169 7:5607511-5607533 GTGCGCTGGGAAGGCGGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020140169 Original CRISPR GTGCGCTGGGAAGGCGGTGA TGG Intergenic
No off target data available for this crispr