ID: 1020146842

View in Genome Browser
Species Human (GRCh38)
Location 7:5650939-5650961
Sequence TTAAATATGAAGGATATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 392}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020146842_1020146847 15 Left 1020146842 7:5650939-5650961 CCTTCCATATCCTTCATATTTAA 0: 1
1: 0
2: 0
3: 35
4: 392
Right 1020146847 7:5650977-5650999 ACCCAACTACAGGCTACATACGG No data
1020146842_1020146846 5 Left 1020146842 7:5650939-5650961 CCTTCCATATCCTTCATATTTAA 0: 1
1: 0
2: 0
3: 35
4: 392
Right 1020146846 7:5650967-5650989 ACATAAAGTCACCCAACTACAGG 0: 1
1: 0
2: 0
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020146842 Original CRISPR TTAAATATGAAGGATATGGA AGG (reversed) Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906090354 1:43173467-43173489 TTAAATATGACATATATGTAGGG - Intronic
906485872 1:46234576-46234598 TTAAATATAAAGTAGAAGGAAGG - Intergenic
908710501 1:67008943-67008965 TTAAATATGTAGCACATAGAAGG + Intronic
910015812 1:82521847-82521869 GTAACTATGTTGGATATGGATGG + Intergenic
910150348 1:84135034-84135056 TTAAATATAAAGAATAGGTAAGG + Intronic
910522299 1:88136617-88136639 TGAGATCTGAAGGATAAGGAGGG + Intergenic
910674559 1:89803520-89803542 TTAAATAAGAAATATATGAAAGG - Intronic
913080588 1:115381979-115382001 TTAAATTTGAAGTAAATTGAAGG - Intergenic
915813670 1:158943604-158943626 TTAAACAAAAAGGATATTGAGGG + Intronic
915820665 1:159020162-159020184 TTAAACAAAAAGGATATTGAGGG + Intronic
915984327 1:160448613-160448635 TTAAATATGAATGAATTGGCTGG - Intergenic
916441636 1:164831751-164831773 CAAAATAAGAAGGAAATGGAAGG + Intronic
917308037 1:173647568-173647590 GTAAACAAGAAGAATATGGAAGG + Intronic
918144946 1:181747366-181747388 TTACACATGAAAGATCTGGAGGG + Intronic
919108883 1:193191947-193191969 TTAAATATCAAGAATATGCTGGG - Intronic
919267064 1:195282985-195283007 TTAAACATAGAGGATAAGGAAGG + Intergenic
919948477 1:202340571-202340593 TTAAATATAAAGTATATGGGAGG + Intronic
920591335 1:207221623-207221645 TCAAAAATGGAGGATTTGGATGG + Intergenic
921154879 1:212431883-212431905 TTAAATAGGCAGGTTAGGGAAGG - Intergenic
922624422 1:227023703-227023725 ATACATATGATGGAGATGGAAGG + Intronic
923016439 1:230130197-230130219 TTACAGAAGAAAGATATGGATGG - Intronic
923533357 1:234829230-234829252 TGAAATAGGTAGGATGTGGAGGG + Intergenic
924479853 1:244419425-244419447 TTAAATATGAAGGAGATCTTTGG - Intronic
1063612116 10:7571384-7571406 TTAAAAATAAAGTGTATGGAAGG - Intronic
1064065975 10:12181840-12181862 TTAAAAAAAAAGGATATGGCCGG + Intronic
1064328118 10:14369806-14369828 TTAAACATGATTGAAATGGAGGG - Intronic
1064911683 10:20408575-20408597 TAAAATGTGTAGGATATGAAGGG + Intergenic
1067979697 10:51071900-51071922 TTAAAAATGAACGAGATGGCTGG + Intronic
1068344708 10:55759742-55759764 TTAATCATAAAGAATATGGAGGG + Intergenic
1068658495 10:59598881-59598903 ATAAATATGAAGGCTAATGATGG - Intergenic
1069020406 10:63480925-63480947 ATAAATATGAATTATATGGTAGG - Intergenic
1069326847 10:67241532-67241554 TTAAATAGGAAGGAATTGCAAGG - Intronic
1070974882 10:80598557-80598579 TTTAATATGAAAGATATAGTGGG + Intronic
1071941393 10:90595280-90595302 TAAAAGGAGAAGGATATGGAAGG + Intergenic
1072156060 10:92724767-92724789 TCAAATATCAAGGAAATTGAAGG - Intergenic
1073166989 10:101463681-101463703 TTATAGATGAAGAAAATGGAGGG + Intronic
1073456941 10:103643046-103643068 TTAAATAAGGAGGCTTTGGAGGG - Intronic
1073771540 10:106740321-106740343 TTAAATATTAAGGATATCCCAGG - Intronic
1075231483 10:120683612-120683634 TAAACTAAGAAGGAAATGGAAGG - Intergenic
1075487362 10:122835739-122835761 TTAAACATGAAGGATATTACTGG - Intronic
1077263227 11:1634443-1634465 TTAAATGTAAAGGAAATGGCTGG + Intergenic
1077618960 11:3701993-3702015 TTAAAAATGAAGGATAGGCTGGG + Intronic
1078114026 11:8426809-8426831 TGAAATAACAATGATATGGAAGG - Intronic
1078872961 11:15366036-15366058 TTAAATCTAAAGAATAAGGATGG + Intergenic
1079210153 11:18454107-18454129 TTAAATATTAAGGAGTTGGCCGG - Intergenic
1079514737 11:21253924-21253946 TTAAATTTGAAGGACTAGGAAGG + Intronic
1079704577 11:23598233-23598255 GTGAATTTGCAGGATATGGAAGG + Intergenic
1081260024 11:40948177-40948199 TTGAATATGGAGTATATTGAGGG - Intronic
1081478057 11:43456048-43456070 ATCAATATGAAGGATATTAACGG - Intronic
1081917282 11:46740648-46740670 TTAAAAATGAAGTATATGGGAGG - Intergenic
1082756836 11:57084874-57084896 TTAAATATTGAGGAAATGGATGG - Intergenic
1083076313 11:60042588-60042610 TTAAATATAGAGGATAAAGATGG + Intronic
1083354546 11:62056461-62056483 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1083355475 11:62063054-62063076 CTTAATATGAAGGAAAGGGAAGG + Intergenic
1086891298 11:92261260-92261282 TTAAATAGGAAAGGTAAGGAGGG + Intergenic
1086927387 11:92655091-92655113 TTTAGTAAGAGGGATATGGAAGG - Intronic
1088208401 11:107422650-107422672 TTAAATATAAAGGATATATCTGG + Intronic
1089085903 11:115816490-115816512 TTAAATATGAAGGATCATCACGG + Intergenic
1089251556 11:117166369-117166391 TTAAAAACAAAGAATATGGAAGG - Intronic
1090603809 11:128400678-128400700 TTTAATATGAAAAATATGCATGG - Intergenic
1091366537 11:135025848-135025870 TTAAATCTGAAGTATAGAGAAGG + Intergenic
1091486411 12:893313-893335 TTAAATATGAAATATATATATGG + Intronic
1092695134 12:11163162-11163184 TTAAAAATTTAAGATATGGAAGG - Intronic
1092898093 12:13033040-13033062 TTAAATAGGATGGTTAGGGAAGG - Intergenic
1093234403 12:16588778-16588800 TTAATAATGAAGAATATGAAAGG - Intronic
1093254169 12:16845194-16845216 TTAAGTATCAAGAATATGGCCGG + Intergenic
1093300723 12:17451381-17451403 ATAAAAATTAAGGATATGCATGG + Intergenic
1093338922 12:17947558-17947580 TTAAAGATGAGGTAAATGGAGGG + Intergenic
1093533356 12:20193986-20194008 TAAAATATCTAGGATTTGGATGG + Intergenic
1093791731 12:23259086-23259108 TTAAAAATTTAGGATTTGGAGGG + Intergenic
1094320774 12:29180460-29180482 CTAAACATGAAGGATGTGGATGG - Intronic
1094564547 12:31588269-31588291 TTAAATAAGATGGTTAGGGAAGG - Intronic
1095973376 12:47921347-47921369 TTAAATTTGAAGGTAATGTAGGG - Intronic
1097672698 12:62559005-62559027 TTTAATAAAAAGAATATGGAGGG + Intronic
1098390007 12:69959646-69959668 TTAAATATGCGCCATATGGATGG + Intergenic
1098423652 12:70333577-70333599 TTAAATGTAAAGGAAGTGGAAGG + Intronic
1098590587 12:72206616-72206638 TTAAAAAAGAAGTATATGGCTGG - Intronic
1099933506 12:89099683-89099705 TTAAATATGAAGGGGCAGGAAGG - Intergenic
1100023625 12:90101024-90101046 TGAAATATGAAGTATATTCAGGG - Intergenic
1100070506 12:90710394-90710416 TTTAATAGGGAGTATATGGAGGG - Intergenic
1100117352 12:91323500-91323522 TGAATTATGAATGTTATGGATGG + Intergenic
1100166301 12:91921633-91921655 CGAAATATGCAGAATATGGATGG - Intergenic
1101055565 12:100909104-100909126 TTAAATTTGAAGAATGTGGATGG + Intronic
1101667922 12:106837048-106837070 TTAAATAGGATGGTTAGGGAAGG - Intronic
1103129510 12:118455018-118455040 TTAGATATGTTGGATATAGAAGG + Intergenic
1103506690 12:121445776-121445798 TTAAATATGGAGGTCAGGGAAGG + Intronic
1103969026 12:124658106-124658128 TTAAATAGGAAGGTCAGGGAAGG + Intergenic
1106686705 13:32067921-32067943 ATAAATAGGAAGGAAAAGGAGGG - Intronic
1106986020 13:35351566-35351588 TTACATTTTAAGAATATGGAGGG + Intronic
1108028087 13:46199683-46199705 GTAAATATGAAGGAGAAGGGAGG + Intronic
1108545573 13:51489821-51489843 TTAAATATAAAAGATATTTAGGG - Intergenic
1109594529 13:64532832-64532854 TCAGATATGAAGGATGTGGGGGG - Intergenic
1109595136 13:64542899-64542921 TTAGAAATGAAGTCTATGGATGG + Intergenic
1110464751 13:75788556-75788578 TTAAATATGTAAGATATGTCTGG - Intronic
1110925610 13:81147180-81147202 TTCAAGATGAAAGATTTGGATGG + Intergenic
1110957456 13:81573327-81573349 TTCAATATGACTGATAAGGATGG + Intergenic
1112956592 13:105066749-105066771 TGAAAAAAGAATGATATGGAAGG + Intergenic
1113322488 13:109249050-109249072 GTAAATATGAAGGAGAGGGATGG - Intergenic
1113536216 13:111068152-111068174 TAAACTTTAAAGGATATGGATGG + Intergenic
1114247561 14:20928756-20928778 TTCAAGATGAAGGATCTGGCAGG + Intergenic
1114430048 14:22653096-22653118 TTAGAAATGAGGGATATGGATGG - Intergenic
1114765297 14:25364051-25364073 CTAAATATGAAGGAATTGAAAGG + Intergenic
1115193970 14:30776679-30776701 GTAAAGATGAAGGAAAGGGAAGG - Intergenic
1115803233 14:37019873-37019895 TTAAAGATGTAAGATATAGATGG + Intronic
1115939368 14:38591394-38591416 TTAACTTTGAAAGATATGTAGGG - Intergenic
1117229799 14:53705107-53705129 TTAAATAAGAAGGAGGGGGAGGG + Intergenic
1117312346 14:54540540-54540562 GTAAATATGAAGAATTTGGTAGG + Intergenic
1117615044 14:57526431-57526453 TTAAATATAAAGAATTTAGAAGG - Intergenic
1120021153 14:79531957-79531979 ATAAAGGTGAAGGATATAGAGGG - Intronic
1120280940 14:82437209-82437231 TTAAATATCAGTGATATGGTTGG + Intergenic
1121922542 14:97896375-97896397 TAAAATATGAAGCAGTTGGAAGG + Intergenic
1123206258 14:106716135-106716157 GAGAATATGAAGGATATGGATGG - Intergenic
1123211340 14:106763544-106763566 GAGAATATGAAGGATATGGATGG - Intergenic
1123477442 15:20599507-20599529 TTAAAGATGCAGGAGATTGAGGG - Intergenic
1123640574 15:22400875-22400897 TTAAAGATGCAGGAGATTGAGGG + Intergenic
1124889926 15:33723421-33723443 TTAAATGTTAAGGATATAGTTGG + Intronic
1125098764 15:35885595-35885617 CTACATATGGAGGATATGGTGGG + Intergenic
1126192295 15:45890530-45890552 TTGGGTATGAAGGATAGGGAGGG + Intergenic
1126212236 15:46112839-46112861 ATAGAAATGTAGGATATGGATGG + Intergenic
1126632535 15:50752125-50752147 TTTAAAAAGAAGGATATGGCTGG - Intronic
1128950108 15:71870713-71870735 CTAGATATAAAGTATATGGAAGG - Intronic
1129553786 15:76483046-76483068 TTAAATAAGAAGGATAAAGTTGG + Intronic
1130353153 15:83108490-83108512 TTCAATGTGAAGGAAATGGGTGG + Intronic
1131243637 15:90770828-90770850 TTCCTTATGAAGGATATGAATGG + Intronic
1131489082 15:92846548-92846570 TTAACTATTAAGGTTATGGGTGG + Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1134412661 16:14015967-14015989 TTAAACATGAAGGATTGTGAAGG - Intergenic
1135156964 16:20060882-20060904 CGAAATCTGAAGGACATGGAAGG - Intronic
1135560630 16:23474078-23474100 TTAAAAGGGAAGGAAATGGAAGG - Intronic
1135893484 16:26377542-26377564 TGAAATATGAATGATAAGAAGGG + Intergenic
1136669978 16:31847514-31847536 TTTATTAGGAAGGAAATGGAGGG + Intergenic
1139045213 16:63049540-63049562 TTAAATGTGAAAGATTTAGAAGG - Intergenic
1139123465 16:64048430-64048452 TAAATTGTGTAGGATATGGATGG + Intergenic
1140633814 16:76887382-76887404 TTAAACATCAAGGATGTGGTAGG + Intergenic
1141341472 16:83207947-83207969 TAAAAGATGAAGGATCTGGATGG + Intronic
1141409045 16:83820209-83820231 TTAAATCACAAGGATATTGAGGG + Intergenic
1141556640 16:84840887-84840909 TTAAATATCAGGTATGTGGAAGG - Intronic
1142614813 17:1128021-1128043 TTAACCAGGAGGGATATGGAAGG - Intronic
1144565509 17:16355800-16355822 TTAAAAATGAAGAACATGGCTGG + Intergenic
1144622725 17:16828817-16828839 TTAAATATTTAAAATATGGAAGG + Intergenic
1144883706 17:18443899-18443921 TTAAATATTTAAAATATGGAAGG - Intergenic
1145148525 17:20500487-20500509 TTAAATATTTAAAATATGGAAGG + Intergenic
1146278919 17:31532507-31532529 ATAAAAATGAAGGAGAAGGAGGG + Exonic
1148548355 17:48533670-48533692 TTAATTATGAAGGCAAAGGATGG - Intergenic
1149572979 17:57687432-57687454 TACAATATGAAGAATATGAAAGG + Intergenic
1150323505 17:64236552-64236574 TTAAAAATAAAGTATATGGGAGG + Intronic
1151617735 17:75225288-75225310 CTAAATATAAAGGGTGTGGATGG + Intronic
1152164619 17:78694481-78694503 TTAAATAAGGAGGATAAAGAAGG + Intronic
1155229422 18:23758215-23758237 ATAAATAAGCAGGATATGGGAGG + Intronic
1155489875 18:26390026-26390048 GTAAATAGCAAGGATCTGGATGG - Exonic
1155818448 18:30345827-30345849 TTAAATGTGAAGAAATTGGAGGG - Intergenic
1157190059 18:45574076-45574098 TTAAATGGGTAGGATTTGGATGG + Intronic
1157609403 18:48946961-48946983 CCAAATTTGAAGAATATGGAAGG + Intronic
1158238511 18:55348776-55348798 TTGAATATGAAGCATAAGGAGGG + Intronic
1158738555 18:60112680-60112702 TAAGATATGGTGGATATGGAAGG - Intergenic
1160918509 19:1508825-1508847 TTAAAAATGAATAATATGTAAGG - Intronic
1167168988 19:47818430-47818452 ATAAATGTGAAAGAAATGGATGG - Intronic
925560833 2:5193249-5193271 GTAATTATGATGGATATGAATGG + Intergenic
925956990 2:8976405-8976427 TTAACTATGAAGCCTAAGGAAGG + Intronic
926872655 2:17440391-17440413 TTACATATTAAACATATGGATGG - Intergenic
927291670 2:21410629-21410651 TTAAAGATAAATGATATGTATGG - Intergenic
928712255 2:34020275-34020297 TTAAACAAGAAGGATAGTGATGG + Intergenic
929132160 2:38587464-38587486 TTAATTTTGAATGATATGGGTGG - Intronic
929203063 2:39258226-39258248 TTTAAAATAAAGGATATGGCTGG - Intronic
929616565 2:43314168-43314190 ATTTATATGAAGGGTATGGATGG + Intronic
929995547 2:46824027-46824049 TTAAAAATGAAGAATTTGGCTGG + Intronic
930163540 2:48181788-48181810 TTAAATATAGAGCAGATGGATGG + Intergenic
930387243 2:50712368-50712390 TTAAATCTGAAGAATCTGAAAGG - Intronic
931589825 2:63870741-63870763 TTAAAGATGATGAATATGGTGGG + Intronic
931601067 2:64003578-64003600 TTATAGATGAATGAAATGGATGG + Intronic
932502554 2:72196639-72196661 TGAAATTTGAAGTTTATGGATGG - Intronic
933379565 2:81525651-81525673 TTTAATATCAAGTATTTGGAAGG + Intergenic
933604953 2:84372858-84372880 TTAAATATGATGTTTGTGGATGG - Intergenic
934517993 2:95000709-95000731 TTAAATGTGAAGGGCATGGGTGG - Intergenic
934591537 2:95555416-95555438 TTAAAAATGGAGCATATGAAAGG + Intergenic
934879340 2:97960344-97960366 TTAAACATGAAGAAGGTGGATGG - Intronic
935469941 2:103446811-103446833 TTAAATATGAAGTTTATGAAAGG + Intergenic
935942641 2:108257167-108257189 TTAAATATTAATAATATGGGTGG + Intronic
935959624 2:108411857-108411879 TTAAAAATAAAGTATATGGGAGG + Intergenic
936581840 2:113707064-113707086 TTAAATATTAAATAGATGGAGGG + Intronic
937532357 2:122844728-122844750 TCAAATATGAACTATATGCAAGG - Intergenic
938049086 2:128150780-128150802 TTAAATATGAATGAAATCAAGGG + Intronic
938311470 2:130291734-130291756 TTATCTATGAAAGATCTGGATGG + Intergenic
938626988 2:133121222-133121244 TAAAATATGAAGGAAAAGGAAGG + Intronic
938835539 2:135099864-135099886 CTAAATATAAAGGATACAGAAGG + Intronic
938917879 2:135962073-135962095 TAAAATATGAAGGACTAGGAAGG - Intronic
939362034 2:141184823-141184845 ATAAAGATGAAGGGTATGTAAGG - Intronic
939445375 2:142303448-142303470 TTCGCTATGAAGGATTTGGAGGG + Intergenic
939525551 2:143289401-143289423 TTAAAAATGAAGGATGTAAAAGG + Intronic
939931387 2:148238337-148238359 TTAAAAATGTAGGGTATGCATGG + Intronic
940442823 2:153739082-153739104 ATAAATGTGAAGTATTTGGAGGG - Intergenic
940741077 2:157508323-157508345 CTTAACATGAAGTATATGGATGG + Intergenic
941086302 2:161122025-161122047 TTAAATAGCAAGGATATCCATGG + Intergenic
941162891 2:162055238-162055260 TCCAATATGGAGGCTATGGATGG - Intronic
941599724 2:167527234-167527256 TTAAATATCATTGATATGGTTGG - Intergenic
942505216 2:176634651-176634673 TTAAGTGGGAAGGAAATGGATGG + Intergenic
944200282 2:197099509-197099531 TTTAATATGAAGCATTGGGAAGG + Exonic
945878130 2:215299558-215299580 TTCAAAATGAAGGTAATGGAAGG + Intergenic
945889425 2:215412857-215412879 TGAAAAATGGTGGATATGGAAGG - Intronic
946576318 2:221079813-221079835 ATAATTATTAAGGAAATGGAAGG + Intergenic
947594036 2:231399782-231399804 TTATTTATGAAGAATTTGGAGGG + Exonic
948173289 2:235923837-235923859 TTAAATCTGAAAGATGTGAAAGG + Intronic
1169760006 20:9080935-9080957 ACAAAAATGAAGGATATTGATGG - Intronic
1169820583 20:9705254-9705276 AAAAAGATGAAAGATATGGAAGG + Intronic
1170594878 20:17797719-17797741 TTAAATAAGAAACAGATGGATGG - Intergenic
1175095472 20:56537950-56537972 TTCAATATGGGGGAAATGGAAGG + Intergenic
1177680386 21:24360788-24360810 TTAAATATGAAAAAAATGGGAGG + Intergenic
1178117996 21:29436933-29436955 TTGAAGATGAAGGATGTGTATGG - Intronic
1178511574 21:33209565-33209587 GAAAATATGAAGGATGAGGAGGG + Intergenic
1178907021 21:36644995-36645017 TTAAATATAAAAGAAATGCAAGG + Intergenic
1181480501 22:23196046-23196068 TTAAAAATGAAGGAGAGAGAAGG - Intronic
1181829034 22:25544446-25544468 AAAAAAATGAAGGATAAGGAAGG - Intergenic
1182648172 22:31827510-31827532 TTGAAAATAAACGATATGGAAGG - Intronic
1184215932 22:43067241-43067263 TGAAATATGAAGCATCTGGGAGG - Intronic
1184990137 22:48161954-48161976 TTAAAAATGAAGGGTCTGGCTGG - Intergenic
1184991396 22:48172551-48172573 TAAAATCTGAAGGATATAAAGGG - Intergenic
949130109 3:489836-489858 TAAAATATCAAGGATTTGCAAGG - Intergenic
950570636 3:13797897-13797919 AAAAATATAAAGGATATGGCTGG + Intergenic
951191527 3:19777632-19777654 TTAAATATAAAAGATATAGGTGG - Intergenic
951301500 3:21003724-21003746 TCAAAGATGTAGGATAAGGATGG + Intergenic
951718791 3:25676331-25676353 ATACATATAAAGGATCTGGAAGG - Intergenic
953064668 3:39458014-39458036 TTAAATATGAAGGTTTAGGCTGG + Intergenic
955459195 3:59161782-59161804 TTAAATGAGATGGCTATGGAGGG + Intergenic
955581932 3:60432428-60432450 TTATAGATGACGCATATGGATGG - Intronic
956336771 3:68173784-68173806 TTAAAAATGAAGGGAAGGGAAGG - Intronic
956635905 3:71364631-71364653 TTAAATTTGAAGGATGTGATAGG - Intronic
958192590 3:90201834-90201856 TTAAATATGAATTGAATGGAGGG - Intergenic
958416007 3:93873763-93873785 TTAAATATGAATTGAATGGAGGG - Exonic
958552350 3:95632540-95632562 GAAAATATGAATGATGTGGAAGG + Intergenic
959666457 3:108927636-108927658 TTAAAGATACAGGATATGAAAGG - Intronic
959751578 3:109842988-109843010 TTAAATACGTAGGATCTTGAAGG + Intergenic
960180240 3:114567442-114567464 CAATATATGAAGGAGATGGAGGG - Intronic
961616623 3:128187891-128187913 AGAAGTATGAAGGATTTGGAGGG + Intronic
964156956 3:153597814-153597836 TTAAATTTCAAGGAAATGGCAGG - Intergenic
964306231 3:155343375-155343397 TTAAAAATGAATGAATTGGATGG - Intergenic
965129135 3:164671936-164671958 TTAAAAATGAAGGAGATATAAGG - Intergenic
966236586 3:177708271-177708293 TTAGTTATGAATGATATTGAAGG + Intergenic
966336760 3:178876715-178876737 TTAAAAAGGAAGGGTATGAATGG + Intergenic
966515579 3:180817283-180817305 TTAGATATGAAGAATAAGGAAGG + Intronic
966710248 3:182965087-182965109 ATAAACATAAAAGATATGGAAGG + Intronic
967881163 3:194302709-194302731 TTAAATAGGATGGTTAGGGAGGG + Intergenic
970061845 4:12042336-12042358 TCATATATGAGGGATGTGGAAGG - Intergenic
970870625 4:20812828-20812850 TTAAATACTAAGGATAGGGGAGG + Intronic
971966275 4:33561114-33561136 TTAAATATGAAGGCCAGGCATGG + Intergenic
972053185 4:34765774-34765796 TTAATTATAAAGGAAATGGAAGG - Intergenic
972632455 4:40854077-40854099 ATAAATATTAAGCACATGGATGG + Intronic
973125542 4:46579579-46579601 TCAAAGACAAAGGATATGGAAGG + Intergenic
974414707 4:61592529-61592551 TTAAATATAAAGGAAAAGAAAGG + Intronic
975335683 4:73172331-73172353 TTAAACATGAAGGAGAAAGAGGG + Intronic
975641650 4:76506392-76506414 ATAAAAATAAAGTATATGGAAGG + Intronic
975642545 4:76514753-76514775 TTAAAAATGAAGTATAGGGAAGG + Intronic
976526711 4:86100369-86100391 TTTAAAATGAAGGCTATGGAAGG - Intronic
976586804 4:86807510-86807532 TTTAAAATGCATGATATGGATGG + Intronic
976746489 4:88408167-88408189 GTAAATATGAATGGTAAGGAGGG + Intronic
977244239 4:94611607-94611629 TTAAATATGAAGGTTTTGCTTGG + Intronic
978375583 4:108072181-108072203 TTAAATAAGAAGGGAATGGGTGG + Intronic
978548939 4:109903501-109903523 TTAAAAATGAAGATTATGGCCGG + Intergenic
978672560 4:111268092-111268114 TTAAATGTGAAAGAAATGAAAGG + Intergenic
979615229 4:122734560-122734582 TTAAAAATGAAGTATATGGCCGG - Intronic
979645473 4:123061938-123061960 TTAAATATGAACCAGATGGGAGG + Intronic
979652045 4:123146152-123146174 TTAAATATGAGGGAGAAGTAAGG + Intronic
980035253 4:127876214-127876236 TTAAAAATTAAGGCTATGGGAGG + Intergenic
980606208 4:135093223-135093245 TTGAAGGTCAAGGATATGGAAGG + Intergenic
982146974 4:152405371-152405393 TTCGATTTGAAGGATATGGCTGG + Intronic
982300856 4:153878346-153878368 TTAATTATAAAGGATGTAGAGGG + Intergenic
982487923 4:155990391-155990413 TAAAATATGAAGTTTATGCATGG + Intergenic
983252218 4:165357944-165357966 TTAAATAAGAAGGGAAGGGAAGG - Intergenic
983864880 4:172754154-172754176 TAAAATATCAAGAATATGGAAGG - Intronic
983909190 4:173217563-173217585 TTAAATAAGAAAGCTATGGAAGG - Intronic
984055336 4:174921731-174921753 CTAAATATGTAATATATGGAAGG + Intronic
985884285 5:2664390-2664412 TTAAATATTAAGGGTAGGCAGGG + Intergenic
986849724 5:11796777-11796799 ATAAAAATGTAGGAAATGGATGG - Intronic
987565458 5:19578425-19578447 TTTAATATGAAGGATTTCGAGGG - Intronic
987739491 5:21887688-21887710 TCATATATGAAGGACCTGGAGGG - Intronic
987816910 5:22914026-22914048 TTAAATATGGGAGATATGGAAGG - Intergenic
988130847 5:27104053-27104075 TTAAATGTGAATGATGTGAATGG - Intronic
988460940 5:31437412-31437434 TTAATTATGAGGAATAGGGAAGG - Intronic
990397291 5:55395107-55395129 TAAAATATAAAGGAAATGGCTGG + Intronic
991103166 5:62815763-62815785 GAAAATATGAAGGAAATGGATGG - Intergenic
991187715 5:63829718-63829740 TTAAAAATGAAGGATATGATTGG + Intergenic
992615386 5:78542154-78542176 TTATTTTTGAAGGATGTGGAAGG - Intronic
993300107 5:86198193-86198215 TGAAACTTGAAGGATAGGGAAGG + Intergenic
993416774 5:87643192-87643214 TTTCATATGAAGGATCTAGAAGG - Intergenic
993595881 5:89854638-89854660 TAAGATATGAATGATATGCATGG + Intergenic
993606848 5:90001305-90001327 TTAAAAATACAAGATATGGATGG + Intergenic
993626810 5:90235382-90235404 TTAAATACAAAGGATATGGTGGG + Intergenic
994628179 5:102247798-102247820 GTAAGGATAAAGGATATGGAAGG - Intronic
994798779 5:104342984-104343006 TAAAACCTGAAAGATATGGAGGG + Intergenic
995360855 5:111295304-111295326 AGAAATTTGTAGGATATGGAGGG - Intronic
995817033 5:116182275-116182297 TTTAATATTAAGATTATGGATGG + Intronic
995984534 5:118153502-118153524 GTAAATATCAAGGAGATGGGAGG + Intergenic
996377500 5:122828768-122828790 TTATATATGAAATATATTGACGG + Intronic
996610643 5:125375126-125375148 TTAAATATGAAACAAAAGGAAGG - Intergenic
1000394772 5:160761830-160761852 AAAAAAATGTAGGATATGGATGG + Intronic
1000489246 5:161888931-161888953 TTAAATACTGAGGATATGGCCGG + Intronic
1001626271 5:173137235-173137257 TTAAAGATGTAGGAAGTGGAAGG - Exonic
1003433107 6:6058375-6058397 TTGAACATGAAGGATTGGGAAGG - Intergenic
1003532564 6:6949894-6949916 TCAAATATGATGGATAAGGAAGG + Intergenic
1005137331 6:22584704-22584726 TTAAATGTGAAAGCTGTGGATGG - Intergenic
1005211221 6:23466376-23466398 TTATAGATGAAAGATAGGGAAGG - Intergenic
1005352786 6:24953035-24953057 TTAATAATGAAGGTTATGGCTGG + Intronic
1005463011 6:26086953-26086975 TCAATTATGAAGGCTGTGGAAGG + Intergenic
1006145573 6:31957336-31957358 TTCAATATGCAGGAAATAGATGG - Intronic
1006634090 6:35449975-35449997 ATAAATATGAAACCTATGGATGG + Intergenic
1006818235 6:36868370-36868392 AGAAATATGATAGATATGGAAGG + Intronic
1008573987 6:52841634-52841656 TTAACTTTGCAGGATATGGAAGG + Intronic
1008577092 6:52871157-52871179 TTAACTTTGCAAGATATGGAAGG + Intronic
1009034816 6:58104094-58104116 TTAAATATGAATGGTATGATTGG + Intergenic
1009198123 6:60711582-60711604 GTATAGATGAAGGAAATGGAAGG + Intergenic
1009210279 6:60854511-60854533 TTAAATATGAATGGTATGATTGG + Intergenic
1009669277 6:66725943-66725965 TGATAGATGAAGGATATGGATGG + Intergenic
1010171934 6:72985307-72985329 TTAAATATTGAGAAAATGGAAGG + Intronic
1011222107 6:85065551-85065573 TAAAATCTGAAGGAAAGGGAGGG + Intergenic
1012402390 6:98852915-98852937 TAAAATATGAATGCTATGTAGGG - Intergenic
1012705473 6:102523284-102523306 TAAAATTTTAAGTATATGGATGG - Intergenic
1012817978 6:104048594-104048616 TTGATTATGAAGGAGTTGGAGGG - Intergenic
1014831755 6:126111014-126111036 TTAGGAATGAAGGATATGGGAGG + Intergenic
1015738750 6:136430612-136430634 TTTAATAGGAATGATATGGTAGG + Intronic
1016164493 6:140923417-140923439 TTTAATATTATGTATATGGAAGG + Intergenic
1016693844 6:146969523-146969545 TCAAATAGGAAAGGTATGGATGG - Intergenic
1016747433 6:147595856-147595878 TGAAACATGAGGAATATGGATGG - Intronic
1017410590 6:154163414-154163436 TTAATTAGGAAGGACATGAAAGG - Intronic
1017856656 6:158355660-158355682 TTAAATTTGAAAGATATGTAGGG + Intronic
1018169228 6:161131281-161131303 TTTAATATGAAGGTTGTGAATGG - Exonic
1018885560 6:167932971-167932993 TTAAATAAGAAGCATACAGAAGG - Intronic
1019133032 6:169891151-169891173 ATAAAGATGAAGGACAAGGAGGG + Intergenic
1020146842 7:5650939-5650961 TTAAATATGAAGGATATGGAAGG - Intronic
1020882146 7:13775654-13775676 TTCAATATGAAGGGTAAGGGTGG + Intergenic
1021600655 7:22359967-22359989 TAAAATATATAGAATATGGATGG - Intergenic
1021948328 7:25750329-25750351 CTAATAATGAAGGAAATGGATGG + Intergenic
1022179544 7:27905287-27905309 TTATATATGACATATATGGAAGG + Intronic
1022694414 7:32690211-32690233 TGAAAGATGAGGGATGTGGAGGG - Intergenic
1023083346 7:36545958-36545980 TGTAATGTGAATGATATGGAAGG - Intronic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1024827997 7:53415227-53415249 TTGAATATGAGGAATATAGAAGG - Intergenic
1025102147 7:56144264-56144286 TCAGATGTGTAGGATATGGAGGG - Intergenic
1027004606 7:74682225-74682247 TTGAGAATAAAGGATATGGAAGG + Intronic
1027408464 7:77887995-77888017 TTACTTATGAAGAATATGGTTGG + Intronic
1027957595 7:84900958-84900980 TTAAGTTTGAATGATGTGGAAGG + Intergenic
1027958320 7:84911158-84911180 GCAAATATCAAGGATAAGGAGGG + Intergenic
1028374673 7:90133857-90133879 TGAAAGAGGAGGGATATGGAGGG + Intergenic
1028739350 7:94254435-94254457 TTGAATATGGTGGATATGTAAGG - Intergenic
1029009892 7:97248580-97248602 TTAGACATGAAGGATCAGGAGGG - Intergenic
1030010422 7:105160917-105160939 ATAAAAATAAAGTATATGGAAGG - Intronic
1030529314 7:110693379-110693401 TTAAATGTGGAGGACATAGAAGG - Intronic
1031025388 7:116673256-116673278 TAAAACATGAAAGATATGAATGG - Intronic
1031284732 7:119852161-119852183 CTAAAAATGAAGAATCTGGAAGG - Intergenic
1031326263 7:120402484-120402506 TAAGATATGAAAGATATTGAAGG + Intronic
1031792858 7:126132435-126132457 TAAACAATGAAGTATATGGATGG + Intergenic
1031960631 7:127986424-127986446 TATAAAATGAAGGATATGCAAGG - Intronic
1032059097 7:128708855-128708877 TTAAGGATGAGGGATATTGATGG - Intergenic
1032306600 7:130739142-130739164 TTAAATATGAAATTTTTGGAAGG + Intergenic
1032414688 7:131727087-131727109 TAAAATATGAAGCCTCTGGATGG - Intergenic
1032618319 7:133498933-133498955 TTAATTATCAAGAATATGAAAGG - Intronic
1032654728 7:133915477-133915499 TCAGATAAGAAGGATATGGGCGG + Intronic
1032697242 7:134347925-134347947 TAAAACATGAAGGAGTTGGAAGG + Intergenic
1032868464 7:135953926-135953948 GTAAATCAGAAGGATATAGAAGG + Intronic
1037190059 8:16113794-16113816 TTAAGTATAAAGGACTTGGAAGG + Intronic
1037309598 8:17540876-17540898 TTAAAGAGAAAGGATCTGGAAGG - Intronic
1038106613 8:24442226-24442248 GAAAATATGGAGGAAATGGAGGG + Intronic
1039037581 8:33376529-33376551 TAAAATGTGAAGGATAGAGATGG + Intronic
1040475365 8:47771939-47771961 GGAAATATGAATGATATGAATGG - Intergenic
1042423328 8:68618037-68618059 GTAAATAGGAAGGGTATAGATGG - Intronic
1042616095 8:70651099-70651121 TTTAATATTAAGGATTTGGTTGG - Intronic
1043017273 8:74954981-74955003 GTCAATATGAAGGATAATGATGG - Intergenic
1043033060 8:75163273-75163295 TCAAATATGAAGGAAAGAGAGGG - Intergenic
1043155553 8:76774344-76774366 TTAAATCTGAATGAAATGGATGG - Intronic
1043577508 8:81674893-81674915 TTAAATTTGAAGGAGATTTATGG - Intronic
1044420185 8:91986028-91986050 TTAAAATTAAAGGATATGCAAGG - Intronic
1044568344 8:93689964-93689986 TTAAATATGAAATATATAGTAGG + Intergenic
1045128449 8:99121072-99121094 TTATATTAGAAGGATATGGGAGG + Intronic
1045605140 8:103764867-103764889 TTAAATTTGAAGTTTATTGAAGG - Intronic
1046091216 8:109504750-109504772 TTAAATATGAAAGCTATAGATGG + Intronic
1047114923 8:121830806-121830828 TTAAATTGTAAAGATATGGAGGG - Intergenic
1047373635 8:124276372-124276394 TTAAAAATGAACAATATGGCTGG - Intergenic
1047596013 8:126378642-126378664 TTAAAATTGAAGGATACGGCTGG + Intergenic
1047637577 8:126781336-126781358 ATGAATATGAAGGACAAGGAGGG + Intergenic
1047895055 8:129357252-129357274 GCCAATATGAAGGATATGAAGGG + Intergenic
1049124343 8:140773465-140773487 TTAAATATGGTGATTATGGAGGG + Intronic
1050133789 9:2440742-2440764 TAAAAAATACAGGATATGGATGG - Intergenic
1050560149 9:6826950-6826972 TCTAATATGAAGGATGTGGGTGG + Intronic
1050635247 9:7605522-7605544 TTAAATATGCAGAATAGGGATGG + Intergenic
1050662987 9:7903697-7903719 TTAAAAATTAAGGCTATGGGAGG + Intergenic
1050751602 9:8945222-8945244 TTAATTATGATGGAACTGGAAGG + Intronic
1052079311 9:24183554-24183576 TTAAAAACTAAGGCTATGGAGGG + Intergenic
1052149121 9:25090881-25090903 TTAAATATTAATTATATGGTGGG + Intergenic
1052391494 9:27883478-27883500 TCTAATATGAAGGAGATGAATGG - Intergenic
1052887513 9:33664520-33664542 TTGAATATGAAGGAGAAGCATGG - Intergenic
1052983060 9:34463067-34463089 TTAAATAGGATGGACAGGGAAGG + Intronic
1054715828 9:68557068-68557090 TTGGATATGAAGGAGAGGGAAGG - Intergenic
1056162328 9:83909266-83909288 TTAAATAGGAAGGTCATGGTGGG + Intronic
1056358015 9:85822244-85822266 TTAAATAGGAAGGTCATGGTGGG - Intergenic
1056467762 9:86875288-86875310 TAAAATATTAAGGAAATAGATGG - Intergenic
1057711727 9:97451586-97451608 TTTACTATGAAGGATATGGCTGG - Intronic
1059392866 9:114010011-114010033 TTAAAGATGAAGAATATGGCCGG + Intronic
1061175527 9:128993875-128993897 TTAAATATTAAGCACCTGGAAGG + Intronic
1061255703 9:129453490-129453512 GGAAATATGAGGGATAGGGATGG + Intergenic
1061674092 9:132205933-132205955 TAAAAAATGAAGGAAATAGATGG + Intronic
1062139600 9:134948469-134948491 ATAGATATAAAGGATATGAAGGG - Intergenic
1186030911 X:5368040-5368062 TCAAATATAACGGAGATGGATGG + Intergenic
1186087905 X:6011225-6011247 TTAAATATAAAGGATCTTGTGGG - Intronic
1186895485 X:14000611-14000633 TTAAAAAAGATGGAGATGGAGGG + Intergenic
1187567572 X:20467116-20467138 TGAAATATGAATGCTAAGGAGGG - Intergenic
1187978423 X:24728895-24728917 GGAAATATGAAGGATAAGGCAGG - Intronic
1188635857 X:32430361-32430383 TAATATATGAAGGATATTAAAGG - Intronic
1189161792 X:38816798-38816820 TTAAATATGAGGGCCAGGGAAGG + Intergenic
1189178370 X:38980415-38980437 TTAAATATCCAGGATCTAGAAGG - Intergenic
1189592344 X:42528052-42528074 TTTTATATGAAGTATATAGATGG + Intergenic
1189977348 X:46475718-46475740 ATATATAAGAAGGATATGGCTGG + Intronic
1190996337 X:55613726-55613748 TTATATATAAAGGATATATATGG + Intergenic
1192031884 X:67522801-67522823 TTAAAAATGAAAGCTGTGGAAGG + Intergenic
1192609094 X:72549735-72549757 TTAGATATAAATGATAAGGAAGG - Intronic
1193501786 X:82285362-82285384 TTAAATATAAATAATAAGGAAGG + Intergenic
1193645443 X:84063144-84063166 TTAAATATGAATAATATTAATGG - Intronic
1193905725 X:87242280-87242302 TTAAATCAGAAGGAAAAGGAGGG - Intergenic
1193992904 X:88330733-88330755 TTAAATATGGCAGATAGGGAAGG - Intergenic
1196023284 X:111012696-111012718 TTAAGTATCAAGGACATGGTGGG + Intronic
1197430754 X:126360285-126360307 TAAAATGTGAAGGATAGGGTAGG + Intergenic
1197558007 X:127980674-127980696 TTCAATATGACTGATAAGGATGG + Intergenic
1197854023 X:130895466-130895488 TGAACTATGAAAGATAAGGATGG - Intronic
1198277483 X:135110101-135110123 TTAAAGATTAAGGATAATGAAGG - Intergenic
1198957990 X:142152821-142152843 TTTAATATAAAGAATATGTAAGG - Intergenic
1198997565 X:142591678-142591700 TAAAATATGAGGTATATGGCAGG + Intergenic
1202329286 Y:23729807-23729829 TTAAGTCAGAAGGATAAGGATGG - Intergenic
1202346394 Y:23932538-23932560 TTAATTAAGAAGGACAAGGATGG - Intergenic
1202524377 Y:25737552-25737574 TTAATTAAGAAGGACAAGGATGG + Intergenic
1202541485 Y:25940247-25940269 TTAAGTCAGAAGGATAAGGATGG + Intergenic