ID: 1020153963

View in Genome Browser
Species Human (GRCh38)
Location 7:5706396-5706418
Sequence GAACCCTGGGTGCCAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1606
Summary {0: 1, 1: 0, 2: 8, 3: 72, 4: 1525}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020153963_1020153967 27 Left 1020153963 7:5706396-5706418 CCAGCCTCTGGCACCCAGGGTTC 0: 1
1: 0
2: 8
3: 72
4: 1525
Right 1020153967 7:5706446-5706468 CTTTAGATCCTGCATTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020153963 Original CRISPR GAACCCTGGGTGCCAGAGGC TGG (reversed) Intronic
900285919 1:1900226-1900248 GTACCTTGGGAGACAGAGGCAGG + Intergenic
900397849 1:2460530-2460552 GGATCCTGGGAGCCAAAGGCAGG + Intronic
900415806 1:2534129-2534151 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
900426143 1:2580052-2580074 GAGCAGTGGGTGCCAGGGGCTGG + Intergenic
900500529 1:3002329-3002351 GACCCCTCGGTGTCAGAGGAAGG - Intergenic
900601854 1:3506130-3506152 GAGCCCTGGGTCGCAGAGGCAGG + Exonic
901195372 1:7437156-7437178 GATGCCTGGATGCCGGAGGCAGG + Intronic
901201252 1:7468683-7468705 GAACTTGGGGTGACAGAGGCAGG - Intronic
901232280 1:7647835-7647857 GCACTCTGGGTGGCCGAGGCAGG + Intronic
901529221 1:9843127-9843149 GAACCCTGAGGGGCAGAGTCCGG + Intergenic
901542350 1:9927545-9927567 GAACTCTGGGAGGCAGAGGTGGG - Intronic
901553036 1:10010360-10010382 GAACTTTGGGAGGCAGAGGCGGG - Intronic
901588028 1:10314664-10314686 GCACTCTGGGAGGCAGAGGCGGG - Intronic
901596755 1:10391431-10391453 GCACTCTGGGAGGCAGAGGCGGG + Intergenic
901635560 1:10668623-10668645 GAGCCCGTGGGGCCAGAGGCTGG - Intronic
901663779 1:10815095-10815117 GATCTGTGGGTGGCAGAGGCCGG + Intergenic
901678677 1:10901129-10901151 CTACTCCGGGTGCCAGAGGCGGG + Intergenic
901962984 1:12841984-12842006 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
902057024 1:13609600-13609622 GAACAGTGGCTGCCAGGGGCTGG - Intronic
902432023 1:16370746-16370768 GAACTCTGGGAGGCTGAGGCAGG - Intronic
902479667 1:16704881-16704903 GCACCCTGGGAGAGAGAGGCAGG + Intergenic
902674296 1:17997778-17997800 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
902803089 1:18842767-18842789 GAAGGATGGTTGCCAGAGGCTGG + Intronic
902931515 1:19734790-19734812 GAATCCTAAGTGCCAGAGCCAGG - Intronic
903056505 1:20639853-20639875 GAACCCAGGGTTACACAGGCCGG - Intronic
903075192 1:20759152-20759174 GAACTCTGGGGGGCCGAGGCCGG + Intronic
903163985 1:21508672-21508694 GCTCCCTGGATGCCAGAGGAGGG - Intergenic
903225637 1:21893009-21893031 GTTCCCTTGGAGCCAGAGGCCGG + Intronic
903326978 1:22574483-22574505 GAATGCTGGCTGCCAGGGGCTGG - Intronic
903391907 1:22970559-22970581 GAACTCTGGGAGGCCGAGGCAGG + Intergenic
903489578 1:23718137-23718159 GAACTATGGTTGCCAGGGGCTGG + Intergenic
903581276 1:24372801-24372823 GAACCTTGGGCCCCAGAAGCAGG - Intronic
904116802 1:28168580-28168602 GAACGGTGGTTGCCAGGGGCTGG + Intronic
904246038 1:29188882-29188904 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
904378572 1:30096536-30096558 TAACCCGGGGTGCCAGGGGCAGG - Intergenic
904529400 1:31158242-31158264 GCACTCTGGGAGGCAGAGGCGGG + Intergenic
905423789 1:37866985-37867007 GAACTTTGGGAGGCAGAGGCGGG + Intronic
905486910 1:38305841-38305863 GAATGCTGGTTGCCAGAGGCTGG + Intergenic
905506917 1:38487207-38487229 GAACCATGGTTACCAGGGGCAGG - Intergenic
905680273 1:39865588-39865610 GCACCGTGGGTGGCTGAGGCAGG + Intronic
905723713 1:40229866-40229888 GAACTCTGGGAGGCCGAGGCAGG + Intronic
905890112 1:41513483-41513505 GTAGCCTCCGTGCCAGAGGCGGG + Exonic
906816261 1:48882783-48882805 GAACAGTAGTTGCCAGAGGCTGG - Intronic
907014605 1:50999763-50999785 GAAGCATGGTTACCAGAGGCTGG + Intergenic
907014837 1:51002540-51002562 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
907309004 1:53528803-53528825 GAACTCTGTGGGTCAGAGGCTGG - Intronic
907540187 1:55208689-55208711 GCACTCTGGGAGGCAGAGGCAGG + Intronic
907570222 1:55476475-55476497 GAACCCTGGGTGTCACTGACCGG + Intergenic
907614431 1:55909876-55909898 GAATGATGGCTGCCAGAGGCTGG + Intergenic
908275052 1:62461823-62461845 GCACCTTGGGAGGCAGAGGCGGG + Intronic
908421359 1:63961660-63961682 GAATCGTGGTTACCAGAGGCTGG + Intronic
908737998 1:67296364-67296386 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
908937739 1:69395667-69395689 GTAGCCTGGGTGACAGAGGAAGG - Intergenic
910138559 1:83999992-84000014 GAACCCAGCGTGACAGAAGCAGG - Intergenic
910575743 1:88761527-88761549 GAACTCTGGGAGGCTGAGGCAGG + Intronic
910584330 1:88862599-88862621 GCACTTTGGGTGCCTGAGGCGGG + Intronic
910637949 1:89429661-89429683 GAGCCCTGATTGACAGAGGCAGG + Intergenic
910890131 1:92009815-92009837 GCACTCTGGGAGGCAGAGGCAGG - Intronic
911051942 1:93678911-93678933 AAAACATGGGAGCCAGAGGCTGG - Intronic
912257893 1:108079977-108079999 AATCCCTGGGTGCCAAAGGTAGG + Intergenic
912403828 1:109419556-109419578 GCACTCTGGGAGGCAGAGGCAGG + Intronic
912772979 1:112481898-112481920 GCACCTTGGGAGGCAGAGGCGGG + Intronic
913247499 1:116883105-116883127 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
913525060 1:119683362-119683384 TAATCCTGGGAGGCAGAGGCAGG + Intronic
915179621 1:154047077-154047099 GAACAATGGTTACCAGAGGCTGG + Intronic
915253392 1:154607124-154607146 GATCCGTGGGTGCCAGGGACTGG - Intronic
915321863 1:155060835-155060857 GAGTCCTGGATGCCAGAGGAAGG + Intronic
915483720 1:156205286-156205308 GCACTCTGGGAGGCAGAGGCGGG - Intronic
916088195 1:161286537-161286559 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
916307750 1:163358375-163358397 GAACCTTGGGAGGCCGAGGCGGG - Intergenic
916792142 1:168134837-168134859 GAAGCCTGAGTGCAGGAGGCGGG - Intronic
916962278 1:169901280-169901302 TCACCCTGGGTGACAGAGCCTGG - Intergenic
917052542 1:170940289-170940311 GACACCTGTGTGCCAGAGGGTGG - Intronic
917382890 1:174434153-174434175 GAACCCTAGTTGCCCCAGGCAGG - Intronic
917431494 1:174974234-174974256 GCACCCTGGGAGGCCGAGGCAGG - Intronic
917637089 1:176947837-176947859 GAACCCTGGGTGTCAGGTGTTGG - Intronic
918009549 1:180573662-180573684 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
918401521 1:184167513-184167535 GAATGATGGTTGCCAGAGGCTGG - Intergenic
918415367 1:184300532-184300554 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
918695732 1:187544207-187544229 GAACCAATGGTGCCTGAGGCGGG - Intergenic
918822892 1:189281150-189281172 GCACTCTGGGAGGCAGAGGCGGG + Intergenic
918988079 1:191659824-191659846 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
918997106 1:191775834-191775856 GAACTTTGGGAGCCTGAGGCGGG + Intergenic
919157288 1:193782571-193782593 GAATGCTGGTTACCAGAGGCTGG + Intergenic
919711045 1:200728870-200728892 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
919801625 1:201357845-201357867 CAGCCCTGGGTGACAGGGGCGGG - Intergenic
919903004 1:202057618-202057640 GCACCCTGGGAGGCCGAGGCGGG + Intergenic
919907006 1:202085209-202085231 GAGCCCTGGGTGCCAGGAGGGGG + Intergenic
919983718 1:202658505-202658527 ATAGCCTGGGGGCCAGAGGCGGG - Intronic
920363507 1:205435796-205435818 TAAACCTGGGTGCCTGAGCCAGG + Intronic
920411107 1:205761670-205761692 GCACCCTGGGTGGCCGAGGTGGG - Intergenic
920587249 1:207178413-207178435 GAATGGTGGGTGCCAGAGGCTGG - Intergenic
920616135 1:207494738-207494760 GAATACTGGTTACCAGAGGCTGG + Intergenic
920757358 1:208746253-208746275 GAACGGTGGTTACCAGAGGCTGG - Intergenic
920896225 1:210052414-210052436 GCACCCTGGGAGGCCGAGGCGGG + Intronic
920934086 1:210414937-210414959 GAACCCAGGGAGGCAGAGGTTGG + Intronic
922086956 1:222358677-222358699 GAATGCTGGTTACCAGAGGCTGG + Intergenic
922346975 1:224704412-224704434 AAACCCAGGGATCCAGAGGCAGG + Intronic
922756008 1:228097324-228097346 GAAGCCTGGGTGCGGGATGCAGG - Exonic
922950877 1:229558139-229558161 GTACCCTGAGCGCCGGAGGCTGG - Exonic
923011097 1:230088259-230088281 GAATGGTGGGTGCCAGGGGCTGG - Intronic
923022929 1:230178939-230178961 GATCGCTGGTTGCCAGGGGCTGG - Intronic
923255748 1:232219968-232219990 GAACAGTGAGTGCCAGAGACGGG - Intergenic
923279250 1:232426412-232426434 GCACTCTGGGAGGCAGAGGCTGG + Intronic
923286069 1:232497138-232497160 GAGCCATGGCTGCCAGGGGCTGG + Intronic
923475327 1:234326284-234326306 GAATGCTGGTTGCCAGTGGCTGG + Intergenic
923691238 1:236195274-236195296 GAAGGATGGTTGCCAGAGGCTGG - Intronic
923703216 1:236319479-236319501 GCACCCTGGGAGGCCGAGGCAGG - Intergenic
923754590 1:236779598-236779620 GAACCATATGAGCCAGAGGCAGG + Intergenic
923765829 1:236891513-236891535 CCACCATGGGTGTCAGAGGCAGG + Intronic
923983934 1:239357957-239357979 GAACTATGGTTACCAGAGGCTGG - Intergenic
924005308 1:239603027-239603049 GAATGGTGGTTGCCAGAGGCTGG - Intronic
924142899 1:241044676-241044698 GAACCTTGGGTGGCTGAGGTGGG - Intronic
924543136 1:245000063-245000085 GCACCCTGGGAGGCTGAGGCAGG - Intronic
924662034 1:246029423-246029445 GCACCTTGGGAGACAGAGGCGGG + Intronic
924664395 1:246055826-246055848 GAATGGTGGTTGCCAGAGGCTGG + Intronic
924700006 1:246441856-246441878 GCACCCTGGGGGCCCGAGGCGGG - Intronic
924751320 1:246894324-246894346 GCACTCTGGGAGGCAGAGGCGGG + Intronic
924869022 1:248020027-248020049 GCACTCTGGGAGCCTGAGGCAGG - Intronic
1062951475 10:1507012-1507034 GGTCCCTGAGTGCCACAGGCTGG - Intronic
1063621925 10:7657291-7657313 GAACTTTGGGAGGCAGAGGCGGG - Intronic
1064007096 10:11707554-11707576 GAACCCAGGGAGGCTGAGGCAGG - Intergenic
1064083164 10:12324549-12324571 GAACACTGGGAGGCTGAGGCAGG - Intergenic
1064121621 10:12623830-12623852 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1064361893 10:14673303-14673325 GAACAGTGGTTACCAGAGGCTGG - Intronic
1064432666 10:15284659-15284681 GCACTCTGGGAGCCTGAGGCGGG - Intronic
1064438496 10:15332200-15332222 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1064474668 10:15674683-15674705 GAACTCTGGGAGGCTGAGGCGGG + Intronic
1064479276 10:15723088-15723110 GCACTCTGGGAGGCAGAGGCTGG + Intergenic
1064918057 10:20484426-20484448 GAACCTTGGATGGCAGATGCTGG - Intergenic
1065224890 10:23533689-23533711 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1065619407 10:27565038-27565060 GAAGACTGGTTGCCAGAGGCTGG - Intergenic
1066130573 10:32389395-32389417 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
1066180108 10:32953732-32953754 GAAACCTGGGTGTCAGTGCCGGG - Intronic
1066219839 10:33324884-33324906 AAACATTGGGAGCCAGAGGCAGG - Intronic
1066259335 10:33713764-33713786 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1066818843 10:39456605-39456627 GAATCACGGGAGCCAGAGGCAGG + Intergenic
1067082692 10:43220457-43220479 CATCCCTGGGTGACAGAGCCTGG + Intronic
1067100139 10:43329045-43329067 GCACCCTGGGAGGCCGAGGCAGG - Intergenic
1067333885 10:45346425-45346447 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
1067364133 10:45609460-45609482 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1067485265 10:46643072-46643094 GCACTCTGGGTGGCTGAGGCAGG - Intergenic
1067609492 10:47698591-47698613 GCACTCTGGGTGGCTGAGGCAGG + Intergenic
1068125385 10:52835551-52835573 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1068535465 10:58236656-58236678 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1068580392 10:58732532-58732554 GAACTCTGGGAGGCTGAGGCAGG + Intronic
1069193004 10:65513265-65513287 GAACAATGGGTACCAGAGGCTGG - Intergenic
1069320592 10:67166858-67166880 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1069381639 10:67848466-67848488 GAACTCTGGGAGGCTGAGGCGGG + Intergenic
1069509221 10:69028871-69028893 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1069533356 10:69235014-69235036 GCACCCTGGGAGGCTGAGGCGGG + Intronic
1069669656 10:70190975-70190997 GAACTTTGGGAGCCTGAGGCGGG + Intergenic
1069712387 10:70498094-70498116 GAACTGTGGGTGCCAGGGCCTGG - Intronic
1069751218 10:70746398-70746420 GATCCGTGGCTGCCAGGGGCTGG + Intronic
1069896582 10:71683834-71683856 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1069924813 10:71841622-71841644 GCACCGTGGGAGGCAGAGGCAGG + Intronic
1070158869 10:73853416-73853438 GCAGCCTGGGAGCCAGAGCCTGG + Intronic
1070279069 10:75035734-75035756 GACTCCTGGGAGCCAGAAGCAGG - Intergenic
1070468758 10:76755441-76755463 GAACTGTGGTTGCCAGTGGCTGG - Intergenic
1070788238 10:79174780-79174802 AAACTCTGGATGCCAGAGGCTGG + Intronic
1070817385 10:79333468-79333490 GAACTCTGGGAGGCCGAGGCGGG - Intergenic
1071256018 10:83872314-83872336 GAAGGTTGGTTGCCAGAGGCTGG - Intergenic
1071575706 10:86724356-86724378 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1071625276 10:87162395-87162417 AAACCCTGAGTGACAAAGGCTGG + Intronic
1071835551 10:89414281-89414303 GCACCTTGGGAGGCAGAGGCGGG + Intronic
1072167526 10:92828578-92828600 GCACCCTGGGAGGCTGAGGCTGG - Intergenic
1072336155 10:94400539-94400561 GCACTTTGGGAGCCAGAGGCAGG - Intergenic
1072704079 10:97667454-97667476 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1072840181 10:98764605-98764627 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1073210589 10:101798658-101798680 GAACTTTGGGAGGCAGAGGCGGG - Intronic
1073210929 10:101801898-101801920 GAACTCTGGGAGGCAGAGGCAGG + Intronic
1073365021 10:102932669-102932691 GAACCTTGGGAGGCTGAGGCAGG + Intronic
1073751398 10:106531495-106531517 GAACACTGGGAGGCCGAGGCGGG - Intergenic
1073887434 10:108056318-108056340 GAATAGTGGTTGCCAGAGGCTGG + Intergenic
1074157523 10:110811840-110811862 TAACCCTGGGTGCCATTAGCCGG - Intronic
1074202820 10:111254570-111254592 GAATGATGGTTGCCAGAGGCTGG + Intergenic
1074325461 10:112446835-112446857 AAACCCTGGCAGCGAGAGGCTGG + Exonic
1074361644 10:112828649-112828671 GAACTCTGGGAGGCTGAGGCGGG - Intergenic
1074470786 10:113724853-113724875 GAACGGTGGTTGCCAGGGGCTGG - Intronic
1074596710 10:114874748-114874770 GAACTTTGGGAGGCAGAGGCGGG - Intronic
1074855650 10:117471532-117471554 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1074949001 10:118310225-118310247 GAACTTTGGGAGGCAGAGGCAGG + Exonic
1075324729 10:121522108-121522130 GAACGGTGGTTGCCAGGGGCTGG + Intronic
1075356171 10:121778847-121778869 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1075423791 10:122326351-122326373 GAACGGTGGCTGCCAGGGGCTGG - Intronic
1075525372 10:123180599-123180621 AAACGGTGGTTGCCAGAGGCTGG + Intergenic
1075693079 10:124413437-124413459 GCACTTTGGGTGGCAGAGGCAGG + Intronic
1075911762 10:126131182-126131204 GCACCCAGGGTCCCCGAGGCAGG - Intronic
1076258641 10:129048693-129048715 GACCCCTCGGCACCAGAGGCCGG + Intergenic
1076283799 10:129274298-129274320 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1076668036 10:132103896-132103918 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
1076752727 10:132551772-132551794 GGACCCAGGGGGACAGAGGCAGG + Intronic
1076787872 10:132760006-132760028 GGACCCTGGCGGCCAGAGGCAGG + Intronic
1076906071 10:133361756-133361778 GAAGCGTGGGTGCCAGGAGCTGG + Intergenic
1077040055 11:516935-516957 GAACCATGGGAGCCCGGGGCAGG - Intergenic
1077377829 11:2213634-2213656 GAACAGTGGGTGTCAGGGGCTGG - Intergenic
1077674718 11:4185847-4185869 GAACCCAGGCAGCCAGGGGCAGG - Intergenic
1077729379 11:4713352-4713374 GAACCCTGGGTGCCAGTGTGGGG - Intronic
1077826564 11:5816145-5816167 GAATAGTGGTTGCCAGAGGCTGG + Intronic
1077918106 11:6624054-6624076 GAACCCAGGCTGGCTGAGGCTGG - Exonic
1078097801 11:8311304-8311326 GAAACCTGGGTGCCTCAGGCTGG + Intergenic
1078277553 11:9864631-9864653 GAACTTTGGGTGGCCGAGGCGGG - Intronic
1078370181 11:10737818-10737840 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1078571949 11:12466548-12466570 GCACTCTGGGTGGCCGAGGCGGG - Intronic
1078626097 11:12960002-12960024 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1079624670 11:22601834-22601856 GAACCTTGGGAGGCCGAGGCGGG + Intergenic
1079972127 11:27048271-27048293 GAACAGTGGGTGCCAGGGCCTGG - Intronic
1080017636 11:27524280-27524302 GAATTCTGGGAGGCAGAGGCGGG - Intergenic
1080282447 11:30573461-30573483 AAACCCTGGCTGCCTCAGGCAGG + Intronic
1080755915 11:35198730-35198752 GCACCCTGGGAGGCCGAGGCGGG + Intronic
1081442409 11:43094685-43094707 GAATCGTGGTTGCCAGAGGCTGG + Intergenic
1081538414 11:44012531-44012553 GCACGTTGGGTGGCAGAGGCAGG - Intergenic
1081717664 11:45262291-45262313 GAATGGTGGATGCCAGAGGCTGG + Intronic
1081893900 11:46568209-46568231 GCACTCTGGGTGGCCGAGGCAGG + Intronic
1081959887 11:47128119-47128141 GCACTTTGGGAGCCAGAGGCGGG - Intronic
1082820555 11:57542019-57542041 GAACCTTGGGAGGCCGAGGCAGG + Intergenic
1082904980 11:58297892-58297914 GAACAGTGATTGCCAGAGGCTGG - Intergenic
1083177945 11:60964439-60964461 CAATCATGGGTACCAGAGGCTGG - Intergenic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1083268460 11:61558208-61558230 GCACTTTGGGAGCCAGAGGCAGG + Intronic
1083281822 11:61631498-61631520 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
1083462141 11:62821061-62821083 GCACCCTGGGAGGCCGAGGCAGG + Intronic
1083692479 11:64418799-64418821 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1083699413 11:64465560-64465582 GCACCTTGGGAGGCAGAGGCGGG - Intergenic
1083788831 11:64971179-64971201 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1083805291 11:65069973-65069995 GAGCCCTGGCTGCAAGAGGAGGG + Intronic
1084297665 11:68223481-68223503 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1084505657 11:69565521-69565543 GATCACTGGCTGCCAGAGACTGG + Intergenic
1084517690 11:69645380-69645402 GACCCCTGGGTGCTAGTGGGAGG + Intronic
1084658047 11:70530706-70530728 GAACAGTGGGTGCCCGGGGCTGG + Intronic
1084843199 11:71875777-71875799 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1084943532 11:72626792-72626814 GAAGGCTTGGTGCCAGAGTCAGG - Intronic
1085090187 11:73705299-73705321 GCACTCTGGGAGACAGAGGCAGG + Intronic
1085520623 11:77137234-77137256 GAGCCCTGGGTTCCCAAGGCTGG + Intronic
1085607926 11:77919530-77919552 GCACTCTGGGTGGCCGAGGCAGG - Intronic
1085912864 11:80849245-80849267 GGACCGTGGGAGGCAGAGGCAGG + Intergenic
1086097752 11:83067743-83067765 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1086435554 11:86776672-86776694 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1087043420 11:93823549-93823571 GAACTGTTGTTGCCAGAGGCTGG - Intronic
1087463947 11:98480653-98480675 GAATGTTGGTTGCCAGAGGCTGG - Intergenic
1088088219 11:106006410-106006432 GAAGCTTGGGAGGCAGAGGCGGG + Intronic
1088391678 11:109321471-109321493 GAACCTAGGGAGGCAGAGGCAGG - Intergenic
1088502854 11:110500116-110500138 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1088628499 11:111751083-111751105 GCACTTTGGGAGCCAGAGGCAGG - Intronic
1088878302 11:113953886-113953908 GAACGATGGTTACCAGAGGCTGG - Intergenic
1088892816 11:114058577-114058599 GAAGGTAGGGTGCCAGAGGCGGG - Intergenic
1088906619 11:114159918-114159940 GAACCCTGGGCGGGGGAGGCGGG + Intronic
1088939170 11:114436440-114436462 GAATCGTGGTTGCCAGGGGCTGG + Intronic
1089424815 11:118363862-118363884 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1089492444 11:118892431-118892453 GAACCCAGGGAGGCAGAGGATGG - Intronic
1089948475 11:122502663-122502685 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1089963908 11:122639568-122639590 GCACCCTGGGAGGCAGAGGCGGG + Intergenic
1090259327 11:125307330-125307352 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1090358053 11:126153823-126153845 GAGACCTGGGTGCTAGAGGAAGG - Intergenic
1090381151 11:126328547-126328569 GCACCCTGGGTGGCTGGGGCAGG + Intronic
1090668952 11:128932885-128932907 GCAGCCTGGGTGACAGAGCCAGG + Intergenic
1090824441 11:130374386-130374408 GAACTTTGGGAGCCCGAGGCGGG + Intergenic
1090828850 11:130406854-130406876 GAAATCTGGGTTCCATAGGCTGG + Intronic
1090853460 11:130591141-130591163 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1090885790 11:130875325-130875347 GAACAGTGATTGCCAGAGGCTGG + Intergenic
1090920057 11:131199166-131199188 GATCCCTGTGAGCCAGGGGCTGG - Intergenic
1091630078 12:2153486-2153508 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1091639529 12:2224752-2224774 GCACCGTGGGTCCCAGAGGTGGG + Intronic
1091759987 12:3080785-3080807 GAATAGTGGCTGCCAGAGGCTGG - Intronic
1091849724 12:3685703-3685725 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1091966576 12:4747382-4747404 GAAGCATGGTTACCAGAGGCCGG - Intronic
1092050836 12:5468872-5468894 GCACCTTGGGAGCCCGAGGCAGG + Intronic
1092113249 12:5979793-5979815 GCACCTTGGGAGGCAGAGGCGGG + Intronic
1092123712 12:6061589-6061611 TAATCCTGGGTGGCAGGGGCAGG - Intronic
1092324679 12:7517432-7517454 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
1092809179 12:12256310-12256332 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1092928362 12:13292371-13292393 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1093242475 12:16695275-16695297 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1093323537 12:17744004-17744026 CCACCCTGGGAGGCAGAGGCGGG + Intergenic
1093467752 12:19467538-19467560 GCACTTTGGGAGCCAGAGGCGGG - Intronic
1093469010 12:19481347-19481369 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1093695652 12:22157295-22157317 GCACCCTGGGAGGCTGAGGCTGG - Intronic
1093789524 12:23232032-23232054 GAACTATGGGAGGCAGAGGCGGG + Intergenic
1093904351 12:24672931-24672953 GCACTCTGGGTGGCAGAGGTGGG - Intergenic
1093929756 12:24943736-24943758 GCACCTTGGGTGGCCGAGGCGGG + Intronic
1093984508 12:25514484-25514506 GAAGGATGGTTGCCAGAGGCTGG + Intronic
1094109205 12:26843221-26843243 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1094702021 12:32879284-32879306 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1094732308 12:33192085-33192107 GCACTTTGGGAGCCAGAGGCGGG - Intergenic
1095050374 12:37548726-37548748 GTGCCCTGTGTGCCAGAGGGCGG + Intergenic
1095414266 12:41958959-41958981 GAACTCTGGGATCCTGAGGCAGG + Intergenic
1095435785 12:42186245-42186267 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1095747465 12:45675619-45675641 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
1095984460 12:47990254-47990276 GCACCTTGGGAGCCTGAGGCGGG - Intronic
1095984562 12:47990841-47990863 AAACTCTGGGGGCCACAGGCTGG + Intronic
1096381868 12:51165576-51165598 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1096392077 12:51237535-51237557 GAACCTTGGGAGGCCGAGGCAGG + Intergenic
1096400410 12:51301536-51301558 CCAGCCTGGGTGACAGAGGCTGG - Intronic
1096417065 12:51423785-51423807 GCACCTTGGGTGGCTGAGGCGGG + Intronic
1096559924 12:52428814-52428836 CCACCCTGGGTGCCACAAGCAGG + Intronic
1096804069 12:54129591-54129613 GAACCGTGGGAGGTAGAGGCAGG + Intergenic
1097085637 12:56466214-56466236 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1097094733 12:56537362-56537384 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1097201377 12:57281730-57281752 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1097640511 12:62175270-62175292 GAAACCTGGGTCCCAGACACAGG + Intronic
1097819880 12:64117769-64117791 GAACGGTAGTTGCCAGAGGCTGG - Intronic
1097934373 12:65228640-65228662 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1098032903 12:66272671-66272693 GAACCTTGGGAGTCAGAGGCAGG - Intergenic
1098853057 12:75620420-75620442 GAACTATGGTTACCAGAGGCTGG + Intergenic
1099130020 12:78816818-78816840 GCACCGTGGGAGGCAGAGGCGGG + Intergenic
1099297985 12:80854326-80854348 GCACCTTGGGAGCCTGAGGCAGG + Intronic
1099337730 12:81385680-81385702 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1100192520 12:92208205-92208227 GCACTCTGGGAGACAGAGGCAGG + Intergenic
1100249955 12:92809437-92809459 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1100272296 12:93037950-93037972 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1100308350 12:93371640-93371662 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1100316667 12:93450989-93451011 GCACTTTGGGTGGCAGAGGCGGG - Intergenic
1100601525 12:96115610-96115632 GCACCCTGGGAGGCCGAGGCAGG - Intergenic
1100636560 12:96440112-96440134 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1100831574 12:98520816-98520838 GAACTCTGGGAGGCCGAGGCGGG - Intronic
1100911152 12:99365127-99365149 GCATCTTGGGTGCCAGTGGCTGG + Intronic
1101012635 12:100466901-100466923 TGACCCTGGGTGACAGAGGGAGG + Intergenic
1101122575 12:101598264-101598286 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1101330585 12:103754701-103754723 GCACTTTGGGAGCCAGAGGCGGG + Intronic
1101462236 12:104908016-104908038 GCACTTTGGGTGGCAGAGGCAGG + Intronic
1101885749 12:108660203-108660225 GCACCCTGGGAGGCCGAGGCGGG + Intronic
1101943344 12:109117111-109117133 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1101954702 12:109203028-109203050 GAACAATGGTTGCCAGGGGCTGG - Intronic
1102064294 12:109960375-109960397 GAACCTTGGGAGGCTGAGGCGGG + Intronic
1102113540 12:110383490-110383512 GCACTCTGGGTGGCAGAGGCAGG + Intronic
1102206611 12:111095210-111095232 GAACTTTGGGAGACAGAGGCAGG + Intronic
1102226376 12:111231217-111231239 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1102521098 12:113477777-113477799 GATCCCTGGGGGCCAGAAGGGGG + Intergenic
1102521940 12:113483330-113483352 GAGCACTGGGTCCCAGAGTCTGG - Intergenic
1102861223 12:116338141-116338163 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1103033952 12:117641343-117641365 TAACCTTGGGAGGCAGAGGCAGG - Intronic
1103466722 12:121147857-121147879 GAACTCTGGGAGGCCGAGGCAGG - Intronic
1103470315 12:121175061-121175083 GAACTTTGGGAGCCTGAGGCAGG + Intronic
1103508977 12:121461158-121461180 GGACCCTGCGTGCCAGGGGTGGG + Intronic
1103768438 12:123300409-123300431 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1103997384 12:124839226-124839248 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1104003388 12:124874889-124874911 GAATGGTGGGTGCCAGGGGCTGG + Intronic
1104171060 12:126281062-126281084 GACCCCTGGATCCCAGAGGGTGG + Intergenic
1104209335 12:126672231-126672253 GAATGCTGGTAGCCAGAGGCTGG - Intergenic
1104412849 12:128573675-128573697 GAATGGTGGATGCCAGAGGCTGG + Intronic
1104439330 12:128782082-128782104 CCACCCTGGGTGCCTGGGGCCGG - Intergenic
1104934095 12:132355334-132355356 GAACATGGGGTGCCAGAGCCAGG + Intergenic
1105429320 13:20322926-20322948 GAATCATGGTTGCCAGGGGCTGG + Intergenic
1105521029 13:21131040-21131062 GAACCCTTGGAGGCTGAGGCAGG + Intergenic
1105999719 13:25710436-25710458 GAATGCTGGGTACCAGAGGCTGG - Intronic
1106193698 13:27475784-27475806 GAACGGTGGTTGCCAGGGGCTGG - Intergenic
1106310252 13:28547994-28548016 GAATGGTGGGTACCAGAGGCAGG + Intergenic
1106698572 13:32204954-32204976 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1107425463 13:40288488-40288510 TTTCCCTGGGTTCCAGAGGCAGG - Intergenic
1107470177 13:40684362-40684384 GCACCTTGGGAGGCAGAGGCAGG - Intergenic
1107682349 13:42865023-42865045 AGAACCTGAGTGCCAGAGGCTGG + Intergenic
1107686874 13:42909749-42909771 GAATCATGGTTACCAGAGGCTGG + Intronic
1107936991 13:45353453-45353475 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
1108060031 13:46523731-46523753 GAACTCTGGGAGGCTGAGGCTGG + Intergenic
1108309986 13:49178971-49178993 GAACTCTGGGAGGCCGAGGCAGG - Intronic
1108614389 13:52117163-52117185 GCACCCTGGGAGGCCGAGGCGGG - Intronic
1108685771 13:52817718-52817740 GCACCTTGGGAGGCAGAGGCTGG - Intergenic
1108906736 13:55484945-55484967 GAATGGTGGGTACCAGAGGCTGG - Intergenic
1109178423 13:59184270-59184292 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1109250240 13:60010857-60010879 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1109505987 13:63304194-63304216 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1109833989 13:67831000-67831022 GAATGATGGGTCCCAGAGGCTGG + Intergenic
1110231954 13:73176222-73176244 GAACCTTGGGAGGCTGAGGCAGG + Intergenic
1110291454 13:73812204-73812226 GAATGGTGGCTGCCAGAGGCTGG + Intronic
1110321975 13:74171009-74171031 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1110363978 13:74660572-74660594 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1110438682 13:75503917-75503939 GAACTTTGGGAGCCCGAGGCAGG + Intergenic
1110567620 13:76972146-76972168 GCACCCTGGGAGGCCGAGGCCGG + Intergenic
1110590289 13:77249087-77249109 GAATAGTGGATGCCAGAGGCAGG + Intronic
1110665097 13:78107400-78107422 CAACTGTGGGTGCCAGAAGCAGG - Intergenic
1111178542 13:84631441-84631463 GAACTCTGGTTAACAGAGGCTGG - Intergenic
1111630015 13:90838447-90838469 GAAGGCTGGTTACCAGAGGCTGG - Intergenic
1111959497 13:94794439-94794461 GAACCGTGGTTGCCAGGGGTTGG + Intergenic
1112265815 13:97922328-97922350 GAACACTGGGAGGCTGAGGCAGG + Intergenic
1112418396 13:99225323-99225345 GAAAAGTGGTTGCCAGAGGCAGG - Intronic
1112714290 13:102165840-102165862 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1113512545 13:110867618-110867640 GAGCCCTGGAAGCCACAGGCCGG + Intergenic
1113529928 13:111016362-111016384 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1113794023 13:113046344-113046366 GGACCCAGGGTCCCAGAGCCTGG - Intronic
1113878337 13:113608357-113608379 GAACCACGGTTGCCACAGGCTGG + Intronic
1114180331 14:20361470-20361492 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1114252772 14:20975735-20975757 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1114456101 14:22854502-22854524 GATCCCTGGGAGGCTGAGGCGGG + Intergenic
1115230582 14:31155999-31156021 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1115230793 14:31158504-31158526 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1115534461 14:34359587-34359609 GAACGGTGGCTGCCAGGGGCTGG + Intronic
1115629206 14:35226980-35227002 GAACTTTGGGAGACAGAGGCGGG - Intronic
1116059773 14:39908263-39908285 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
1116361230 14:44000962-44000984 GAAGGTTGGTTGCCAGAGGCTGG + Intergenic
1117312327 14:54540263-54540285 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1117321651 14:54629846-54629868 GAACAGTGGGTGCCAGGGGAAGG - Intronic
1117355205 14:54917425-54917447 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1117385268 14:55205668-55205690 GAACCTTGGGAGGCTGAGGCAGG + Intergenic
1117399536 14:55345973-55345995 GTAGCCTGGGTGACAGAGGAAGG + Intronic
1117440041 14:55750978-55751000 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1117477957 14:56116727-56116749 GAAGCTAGGGTGACAGAGGCAGG + Intergenic
1117546438 14:56797915-56797937 GATCCCCGGGGGCCCGAGGCAGG + Intergenic
1117890430 14:60415657-60415679 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1118205528 14:63719866-63719888 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1118288087 14:64495708-64495730 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1118369925 14:65129263-65129285 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
1118600432 14:67468218-67468240 GCACTCTGGGAGCCCGAGGCGGG - Intronic
1119064931 14:71515886-71515908 GAACTCTGGGAGGCTGAGGCAGG - Intronic
1119142774 14:72282943-72282965 GAATCGTGGTTGCCAGGGGCTGG - Intronic
1119243921 14:73086949-73086971 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1119244108 14:73088892-73088914 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1119402320 14:74371666-74371688 GCACGCTGGGAGCCCGAGGCAGG - Intergenic
1119507338 14:75184215-75184237 GCACCTTGGGAGGCAGAGGCTGG - Intergenic
1119540118 14:75432428-75432450 GGACCTTGGGAGCCAGAGCCTGG - Intronic
1119811533 14:77524825-77524847 GAACAGTGGTTACCAGAGGCTGG + Intronic
1120014334 14:79453179-79453201 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1120658314 14:87222234-87222256 GCACCTTGGGAGGCAGAGGCGGG + Intergenic
1120708762 14:87771816-87771838 GCACCTTGGGTGGCTGAGGCAGG - Intergenic
1120910963 14:89666311-89666333 GCACGTTGGGAGCCAGAGGCAGG - Intergenic
1121093235 14:91197562-91197584 GAATTGTGGTTGCCAGAGGCTGG - Intronic
1121139000 14:91524470-91524492 CAACCCTGGGTGACAGAGTGAGG - Intergenic
1121367679 14:93329763-93329785 GAACTGTGGGTGCCAGGGGCTGG + Intronic
1121451241 14:94009480-94009502 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
1121581041 14:95030915-95030937 GAACAATGGTTACCAGAGGCTGG + Intergenic
1121592134 14:95123650-95123672 GCACTTTGGGAGCCAGAGGCAGG - Intronic
1122236256 14:100332211-100332233 GGGCACTGGGGGCCAGAGGCAGG + Intergenic
1122469953 14:101959717-101959739 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1123049637 14:105534765-105534787 GGGGCCTGGGTGCCAGAGGGAGG + Intergenic
1123063747 14:105606073-105606095 GCACCCAGGGTCCCAGGGGCAGG - Intergenic
1123063753 14:105606083-105606105 GGACCCTGGGTGCCCAGGGCTGG + Intergenic
1123388805 15:19848285-19848307 GCACCATGGGAGGCAGAGGCGGG - Intergenic
1123735686 15:23180330-23180352 GTTCCCTGAGCGCCAGAGGCTGG + Intergenic
1123904636 15:24909495-24909517 GAAGCCTGCGGGCCAGCGGCAGG + Intronic
1124286401 15:28403313-28403335 GTACCCTGAGCGCCAGAGGCTGG + Intergenic
1124296302 15:28508323-28508345 GTACCCTGAGCGCCAGAGGCTGG - Intergenic
1124328059 15:28783973-28783995 GCACCCTGGGAGGCGGAGGCGGG - Intergenic
1124913938 15:33950183-33950205 GAACAGTGGTTGCCAGAGGCTGG + Intronic
1125152982 15:36554638-36554660 GAACTCTGGGAGGCCGAGGCGGG - Intergenic
1125651335 15:41320524-41320546 GCACCCTGGGAGGCCGAGGCTGG - Intronic
1125735471 15:41922140-41922162 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1126120984 15:45251348-45251370 GCACACTGGGAGGCAGAGGCAGG - Intergenic
1126438534 15:48662065-48662087 GAAACCTGGGAGGCTGAGGCAGG + Intergenic
1126461674 15:48921282-48921304 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1126708865 15:51434320-51434342 GAAGGATGGGTACCAGAGGCTGG - Intergenic
1126719425 15:51561473-51561495 GCACCCGTGGTGGCAGAGGCAGG + Intronic
1126795244 15:52255206-52255228 GAACCCAAGGTCCCAGAGGGAGG + Intronic
1126829701 15:52588696-52588718 GCACTTTGGGTGGCAGAGGCGGG - Intronic
1126834413 15:52645190-52645212 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1127069750 15:55277394-55277416 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1127081668 15:55386646-55386668 GCACCTTGGGAGCCTGAGGCGGG + Intronic
1127331184 15:57941728-57941750 GAACTCTGGCTGCTAGAGACAGG - Intergenic
1127459317 15:59183444-59183466 GAACACTGGGAGGCTGAGGCAGG - Intronic
1127968776 15:63943175-63943197 GAACTTTGGGTGGCAGAGGCAGG + Intronic
1127996117 15:64153892-64153914 GAACCATGGGTGCGGGAGGCAGG - Intronic
1128078131 15:64841257-64841279 GACCCCTGAGAGCCAGGGGCGGG + Intergenic
1128143306 15:65317228-65317250 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1128334664 15:66778326-66778348 GAACTCTGGGAGGCTGAGGCAGG - Intronic
1128746862 15:70120838-70120860 GTACCCTGGGAGGCTGAGGCAGG - Intergenic
1129135773 15:73549344-73549366 GAAGGATGGTTGCCAGAGGCTGG + Intronic
1129254465 15:74326380-74326402 GCACCCTGTGTGCCAGAGCCTGG + Intronic
1129545947 15:76395012-76395034 GAAGGATGGGTGCCACAGGCTGG - Intronic
1130513843 15:84610731-84610753 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1130608512 15:85339158-85339180 GAAACCTGGGATTCAGAGGCTGG + Intergenic
1130798515 15:87236138-87236160 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1130977036 15:88784553-88784575 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1131017804 15:89072227-89072249 GAACTCTGGGAGACCGAGGCAGG + Intergenic
1131079231 15:89520848-89520870 GAACGGTGGTTGCCAGGGGCGGG + Intergenic
1131482577 15:92794632-92794654 GCACTCTGGGAGCCAGAGACAGG + Intronic
1131829440 15:96344775-96344797 GGTCGCTGGGGGCCAGAGGCCGG + Intergenic
1132259614 15:100410984-100411006 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1132349470 15:101130490-101130512 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1132540889 16:509148-509170 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1132562249 16:601474-601496 CACCCCTGGGTGCCAGACTCCGG + Intronic
1132660674 16:1060095-1060117 GAACTCTGGGAGACCGAGGCAGG + Intergenic
1132851312 16:2026302-2026324 GCATCCTGGGGGCCAGTGGCTGG - Intronic
1132940158 16:2502372-2502394 GAAGCCTGGGTCACAGAGGCAGG + Exonic
1133019781 16:2962349-2962371 GAGCCCTGAGTGCCAAATGCTGG + Intergenic
1133203800 16:4220740-4220762 TAACTCTGGGTGGCTGAGGCAGG + Intronic
1133278102 16:4650054-4650076 GAACCTTGGGAGGCTGAGGCGGG + Intronic
1133306147 16:4810856-4810878 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1133326562 16:4945648-4945670 GCACTTTGGGTGGCAGAGGCAGG - Intronic
1133332673 16:4985472-4985494 GAACCTTGGGGGGCTGAGGCGGG - Intronic
1133347308 16:5079441-5079463 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1133527148 16:6616679-6616701 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1133535989 16:6702937-6702959 GAATGCTGGTGGCCAGAGGCTGG - Intronic
1133555778 16:6905305-6905327 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1133702457 16:8321742-8321764 GAACGGTGGTTGCCAGGGGCTGG - Intergenic
1133720512 16:8490212-8490234 GAACTTTGGGAGCCAGAGGTGGG + Intergenic
1133748839 16:8708545-8708567 GCACCTTGGGAGGCAGAGGCAGG - Intronic
1133798415 16:9065238-9065260 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1133892476 16:9893711-9893733 GCACTTTGGGAGCCAGAGGCAGG - Intronic
1134002955 16:10796941-10796963 GAACCTTGGGAGGCTGAGGCAGG + Intronic
1134273913 16:12758914-12758936 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1134356357 16:13485806-13485828 GAATGCTGGTTACCAGAGGCTGG - Intergenic
1134450486 16:14360313-14360335 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1134586149 16:15412824-15412846 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1135029736 16:19028898-19028920 GAACCTTGGGAGGCCGAGGCGGG - Intronic
1135078552 16:19414658-19414680 GAACCTTGGGAGGCTGAGGCGGG + Intronic
1135305687 16:21365778-21365800 GAATGCTGGCTGCCAGAGGCAGG - Intergenic
1135501998 16:23004128-23004150 GAACGGTGGTTGCCAGGGGCTGG + Intergenic
1135604745 16:23813859-23813881 GAAGGATGGGTACCAGAGGCTGG + Intergenic
1135876426 16:26204584-26204606 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1136071948 16:27792613-27792635 GATCCCTGAGTGCCAGGGGGAGG - Intronic
1136120869 16:28133089-28133111 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1136277512 16:29187617-29187639 CAGCCCCGGGTGCCTGAGGCAGG + Intergenic
1136277821 16:29189441-29189463 GAGGACTGGTTGCCAGAGGCTGG - Intergenic
1136302430 16:29344932-29344954 GAATGCTGGCTGCCAGGGGCAGG - Intergenic
1136778714 16:32884716-32884738 GAACACTGGGTACCTGAGCCAGG - Intergenic
1136891904 16:33976798-33976820 GAACACTGGGTACCTGAGCCAGG + Intergenic
1137244753 16:46693551-46693573 CAACACTGGGAGGCAGAGGCAGG + Intronic
1137271603 16:46906027-46906049 GAGCCCTGGGTGCCTGGGGCTGG + Intronic
1137909246 16:52359561-52359583 GAACCATGAGTGCCAAGGGCAGG - Intergenic
1137962043 16:52891484-52891506 GAATGCTGGTTACCAGAGGCCGG + Intergenic
1138003747 16:53310599-53310621 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1138013936 16:53412486-53412508 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
1138072767 16:54009640-54009662 GAAGCCTGGCGGACAGAGGCTGG - Intronic
1138474723 16:57263980-57264002 AAACCCTAGCAGCCAGAGGCAGG - Intronic
1138628919 16:58277897-58277919 GAATGGTGGGTGCCAGGGGCTGG + Intronic
1138764690 16:59587823-59587845 GAAGCATGGTTACCAGAGGCTGG - Intergenic
1138833835 16:60409221-60409243 GAACCTTGGGAGGCTGAGGCAGG - Intergenic
1139187665 16:64825817-64825839 GAACCTTGGAAGCCAGGGGCTGG + Intergenic
1139388333 16:66588899-66588921 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
1139400298 16:66675969-66675991 GTTCCTTGGGTGGCAGAGGCGGG - Intronic
1140501738 16:75439239-75439261 GCACCCTGGGAGGCCGAGGCGGG - Intronic
1140512904 16:75520934-75520956 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1140528114 16:75640954-75640976 GTACTCTGGGAGCCCGAGGCGGG + Intronic
1140826086 16:78708077-78708099 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1141184334 16:81776353-81776375 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1141320160 16:83000823-83000845 GAACCTTGGGAGGCCGAGGCGGG - Intronic
1141495139 16:84404357-84404379 GAATGGTGGGTGTCAGAGGCTGG - Intronic
1141532009 16:84652969-84652991 GCACCCTGGGAGGCCGAGGCGGG + Intronic
1141670844 16:85491017-85491039 GTACCCTGGCGGCCAGAGGCAGG - Intergenic
1142064079 16:88050400-88050422 GCACCCTGGGAGGCCGAGGCAGG - Intronic
1142081890 16:88153659-88153681 CAGCCCCGGGTGCCTGAGGCAGG + Intergenic
1142082195 16:88155481-88155503 GAGGACTGGTTGCCAGAGGCTGG - Intergenic
1142394924 16:89826857-89826879 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1203081131 16_KI270728v1_random:1146810-1146832 GAACACTGGGTACCTGAGCCAGG - Intergenic
1142477541 17:198355-198377 GAGGCCTGGGTTCCAGAGTCGGG - Intergenic
1142529339 17:568491-568513 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1142537900 17:632675-632697 GAACGCTGGGTCCCAGAGGCTGG - Intronic
1142594259 17:1021910-1021932 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1142639392 17:1276888-1276910 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1142659476 17:1417905-1417927 GAACTGTGGGAGCCCGAGGCGGG - Intergenic
1142862673 17:2772539-2772561 GCACCTTGGGAGGCAGAGGCAGG - Intergenic
1142938267 17:3357531-3357553 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1142959869 17:3545730-3545752 GCACCCTGGGAGGCTGAGGCGGG + Intronic
1143063660 17:4225107-4225129 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1143081437 17:4384375-4384397 GAACTTTGGGTGGCCGAGGCGGG + Intergenic
1143123600 17:4626002-4626024 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
1143148638 17:4792814-4792836 GAACACTGGGAGGCTGAGGCAGG + Intergenic
1143157143 17:4845029-4845051 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1143237829 17:5418498-5418520 CAACACTGGGAGGCAGAGGCAGG - Intronic
1143273436 17:5692607-5692629 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1143344696 17:6241267-6241289 GAATCCTGGGTGCAAGTGGAAGG - Intergenic
1143578996 17:7813335-7813357 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1143787608 17:9267740-9267762 GCACTTTGGGAGCCAGAGGCAGG + Intronic
1143838683 17:9713432-9713454 GAATGATGGTTGCCAGAGGCCGG - Intronic
1143854302 17:9837279-9837301 GAAGGATGGTTGCCAGAGGCTGG - Intronic
1143916770 17:10299613-10299635 GAATAATGGTTGCCAGAGGCTGG - Intronic
1144170565 17:12656087-12656109 GAACACTGGGTTCCTGAGACCGG + Intergenic
1144392529 17:14808072-14808094 GAAGCCTGGGTGACAGAGTGAGG + Intergenic
1144450713 17:15375996-15376018 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1144561517 17:16324209-16324231 GCACCTTGGGAGCCCGAGGCAGG - Intronic
1144829893 17:18125397-18125419 GAATGGTGGATGCCAGAGGCCGG + Intronic
1145083046 17:19911590-19911612 GAACTTTGGGTGGCTGAGGCGGG + Intronic
1145180156 17:20742432-20742454 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1145305654 17:21673656-21673678 GTGCCCTGTGTGCCAGAGGGCGG - Intergenic
1145361979 17:22219807-22219829 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1145935528 17:28712446-28712468 GTCCCCTGGGGGCCAGGGGCGGG - Intergenic
1146036522 17:29411637-29411659 GCACTTTGGGTGGCAGAGGCAGG - Intronic
1146216795 17:30982932-30982954 GAATGATGGTTGCCAGAGGCTGG - Intronic
1146306624 17:31734755-31734777 GAACCTTGGGAGGCCGAGGCGGG - Intergenic
1146313325 17:31788009-31788031 ACACCATGGGTGCCTGAGGCAGG + Intergenic
1146361070 17:32178277-32178299 GAATCATGGGAGCCCGAGGCAGG - Intronic
1146666166 17:34705365-34705387 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1146705888 17:35000502-35000524 GCACCCTGGGAGACTGAGGCGGG - Intronic
1146875795 17:36409644-36409666 GCACTTTGGGAGCCAGAGGCAGG - Intronic
1147063592 17:37903225-37903247 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1147209403 17:38863171-38863193 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1147255814 17:39181338-39181360 GCACCTTGGGAGCCCGAGGCCGG - Intronic
1147407265 17:40221026-40221048 GAACTCTGGGAGGCAGAGGCGGG - Intronic
1147454488 17:40528318-40528340 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1147696323 17:42357032-42357054 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1147785680 17:42977042-42977064 GCACCCTGGGAGGCTGAGGCAGG + Intronic
1148048044 17:44756004-44756026 GCACCCTGGGAGGCCGAGGCGGG + Intergenic
1148115173 17:45171255-45171277 GGACCCAGGGTTCCAGGGGCAGG - Intergenic
1148165691 17:45482734-45482756 GAGTCCTGGGTGCCAGGGGTGGG + Intronic
1148220219 17:45856006-45856028 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1148343151 17:46885547-46885569 GCACCCTGGGAGACTGAGGCTGG - Intronic
1148368278 17:47072887-47072909 GAGTCCTGGGTGCCAGGGGTGGG - Intergenic
1148997059 17:51719853-51719875 GCAGCCTGGGTGGCAGAGCCAGG + Intronic
1149075147 17:52587751-52587773 GAACAATGGTTACCAGAGGCTGG - Intergenic
1149502863 17:57167788-57167810 GACTCGTGGCTGCCAGAGGCAGG - Intergenic
1149506067 17:57194949-57194971 GAAAGATGGGTGCCATAGGCTGG + Intergenic
1149530177 17:57388898-57388920 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1149805022 17:59608816-59608838 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1150068180 17:62129298-62129320 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1150102857 17:62439349-62439371 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1150396918 17:64829458-64829480 GAGTCCTGGGTGCCAGGGGTGGG + Intergenic
1150501364 17:65653812-65653834 GCACTTTGGGAGCCAGAGGCGGG + Intronic
1150585403 17:66512937-66512959 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1150686185 17:67322722-67322744 GGACCCTGGGAGGCTGAGGCTGG - Intergenic
1150790469 17:68197686-68197708 GCACACTGGGTCCCGGAGGCGGG - Intergenic
1151010850 17:70494222-70494244 GAATGGTGAGTGCCAGAGGCTGG + Intergenic
1151093633 17:71471021-71471043 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1151217296 17:72585983-72586005 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1151525170 17:74660520-74660542 GAAAAGTGGTTGCCAGAGGCTGG + Intergenic
1151556111 17:74847533-74847555 GGACTCTGGGGGCAAGAGGCGGG + Exonic
1151600651 17:75104189-75104211 GAACCCTGGGTCTTAGACGCTGG - Intronic
1151753830 17:76059296-76059318 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1151753887 17:76059698-76059720 GAACGCTGGGAGGCCGAGGCGGG + Intronic
1151761265 17:76104410-76104432 CAAGGCTGGGGGCCAGAGGCAGG - Intronic
1151953199 17:77366640-77366662 GAACCCTGGGAGCAAGTGGCAGG - Intronic
1152032072 17:77849225-77849247 GAACAGTGGTTCCCAGAGGCTGG - Intergenic
1152106674 17:78333759-78333781 GCACTCTGGGTGGCCGAGGCAGG - Intergenic
1152114594 17:78377941-78377963 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1152564231 17:81093033-81093055 CCACCCTGGGTTCCAGATGCAGG - Intronic
1152806351 17:82358461-82358483 GATTCCTGGTTGCCAGGGGCTGG + Intergenic
1152824294 17:82454333-82454355 GAATCATGGGAGCCCGAGGCAGG + Intergenic
1153120964 18:1726306-1726328 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1153226581 18:2905057-2905079 GAACCCTGGTTGAGAAAGGCTGG - Intronic
1153261379 18:3227436-3227458 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1153319801 18:3761257-3761279 GAATGTTGGTTGCCAGAGGCTGG - Intronic
1153485175 18:5590883-5590905 GATCAGTGGCTGCCAGAGGCTGG + Intronic
1153570916 18:6472993-6473015 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1153670611 18:7408433-7408455 GAACGGTGGTTACCAGAGGCTGG - Intergenic
1154262769 18:12852019-12852041 GAATGCTGGCTGCCAGGGGCTGG + Intronic
1154313613 18:13286106-13286128 GAACCATGGGTGTCAGCGGCTGG - Intronic
1154378951 18:13832467-13832489 GCACTCTGGGAGGCAGAGGCGGG + Intergenic
1154387070 18:13903653-13903675 GAAAGATGGTTGCCAGAGGCTGG + Intronic
1154947425 18:21176035-21176057 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1155214259 18:23629229-23629251 GCACCCTGGGAGGCCGAGGCAGG - Intronic
1155217947 18:23659862-23659884 GCACTCTGGGAGCCCGAGGCAGG + Intronic
1155393576 18:25362943-25362965 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1155481548 18:26293812-26293834 GAACAGTAGCTGCCAGAGGCAGG - Intronic
1155510661 18:26573231-26573253 GAATGGTGGATGCCAGAGGCTGG + Intronic
1155543644 18:26891455-26891477 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
1156123177 18:33870314-33870336 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1156514808 18:37670699-37670721 GAAACCTGGGACCCAGAGGAAGG - Intergenic
1157113498 18:44842690-44842712 GACCCAAGGGTGGCAGAGGCAGG + Intronic
1157223596 18:45843630-45843652 GCACCCTGGGAGGCCGAGGCAGG + Intronic
1157524671 18:48371865-48371887 GAGCCATGGGTGCTGGAGGCAGG - Intronic
1157570300 18:48707885-48707907 GATCCGTGGTTGCCAGGGGCTGG - Intronic
1157657798 18:49409036-49409058 GCACCCTGGGAGGCCGAGGCAGG + Intronic
1157749457 18:50165234-50165256 GGACTCTGGGTGGCTGAGGCAGG + Intronic
1157897958 18:51486465-51486487 GATCCATGGTTGCAAGAGGCAGG + Intergenic
1158060475 18:53334596-53334618 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1158135685 18:54205323-54205345 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1158147787 18:54335438-54335460 GAACTTTGGGAGGCAGAGGCGGG - Intronic
1158177820 18:54677384-54677406 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1158274919 18:55756779-55756801 CAAACCTGGCTGCCAGTGGCTGG - Intergenic
1158372835 18:56829226-56829248 GCAGCCTGGGTGACAGAGGGAGG + Intronic
1158496635 18:57960922-57960944 GAATGGTGGCTGCCAGAGGCAGG + Intergenic
1158900202 18:61955221-61955243 GAATGCTGGTTACCAGAGGCTGG - Intergenic
1158938400 18:62385104-62385126 GATCCCTGGGTGGCCGGGGCTGG - Exonic
1158965887 18:62621895-62621917 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
1158973072 18:62686357-62686379 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
1159490390 18:69125730-69125752 GAACAATGGTTACCAGAGGCTGG + Intergenic
1159763227 18:72454543-72454565 GAGCCCTGGGAGGCTGAGGCAGG - Intergenic
1159819256 18:73119269-73119291 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
1159948550 18:74461613-74461635 GAACTATGGGAGGCAGAGGCAGG - Intergenic
1159949193 18:74467748-74467770 GAATGGTGGGTGCCAGAAGCTGG - Intergenic
1160114874 18:76068480-76068502 GAATTGTGGTTGCCAGAGGCTGG - Intergenic
1160439828 18:78880842-78880864 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1160545234 18:79648783-79648805 GGACCCAGGGTGCTAGAGGGGGG - Intergenic
1160964363 19:1739697-1739719 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1160997427 19:1889686-1889708 GAACTTTGGGAGCCCGAGGCGGG + Intergenic
1161046758 19:2139174-2139196 GATTCGTGGGTGCCACAGGCTGG + Intronic
1161142313 19:2654938-2654960 GTCCCCTGGGAGGCAGAGGCAGG + Intronic
1161175849 19:2841781-2841803 GCAGCCTTGGGGCCAGAGGCGGG - Intronic
1161239097 19:3211837-3211859 GCACTCTGGGAGTCAGAGGCAGG + Intergenic
1161295385 19:3517141-3517163 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1161311916 19:3599711-3599733 GAACTCTGGGAGGCTGAGGCGGG - Intronic
1161374226 19:3930998-3931020 GACGCGTGGGTGCCAGGGGCTGG - Intergenic
1161426462 19:4206246-4206268 GCACTTTGGGAGCCAGAGGCAGG + Intronic
1161529097 19:4776461-4776483 GAACCTTGGGAGGCCGAGGCAGG - Intergenic
1161570247 19:5026629-5026651 GGGCCCTGGGTTCCCGAGGCTGG + Intronic
1161570512 19:5028221-5028243 GAACTCTGGGGGGCTGAGGCGGG - Intronic
1161749505 19:6084531-6084553 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1161928972 19:7323421-7323443 GGACAGTGGGTGCCAGGGGCTGG - Intergenic
1161931451 19:7343315-7343337 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1161935766 19:7371227-7371249 GAAAGGTGGGTGCCAGGGGCTGG + Intronic
1161996377 19:7714858-7714880 GAACGGGGGGTGCCAGGGGCTGG - Intergenic
1162000000 19:7738183-7738205 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1162157087 19:8685679-8685701 CAACACTGGGAGGCAGAGGCAGG - Intergenic
1162294630 19:9804808-9804830 CAACACTGGGAGGCAGAGGCAGG - Intergenic
1162335784 19:10059448-10059470 CCACCCTGGGTGACAGAGGGAGG + Intergenic
1162399795 19:10438473-10438495 GAAGAGTGGGTGCCAGCGGCTGG - Intronic
1162425991 19:10596030-10596052 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1162447904 19:10735282-10735304 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1162470006 19:10867152-10867174 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1162484619 19:10951724-10951746 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1162489351 19:10982977-10982999 AAACCCAGGGTGTCAGAGCCAGG + Intronic
1162521335 19:11181580-11181602 GAATGGTGGGTGCCAGGGGCTGG + Intronic
1162619492 19:11829885-11829907 GAACTTTGGGAGCCTGAGGCAGG + Intronic
1162638925 19:11991886-11991908 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1162842479 19:13366541-13366563 GAACTTTGGGAGGCAGAGGCTGG - Intronic
1162850806 19:13429938-13429960 GAACGGCGGGTGCCAGGGGCTGG + Intronic
1162872348 19:13595800-13595822 GAATGATGGGTGCCAGGGGCTGG + Intronic
1162984864 19:14263219-14263241 GCACTCTGGGAGCCTGAGGCAGG + Intergenic
1163011152 19:14427187-14427209 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1163029397 19:14534368-14534390 GCACCCTGGGAGGCCGAGGCGGG - Intronic
1163132944 19:15287614-15287636 GAATGGTGGTTGCCAGAGGCAGG - Intronic
1163136033 19:15311900-15311922 GAAGACTGGCTGCCACAGGCTGG + Intronic
1163180956 19:15601380-15601402 GCACCCTGGGAGGCCGAGGCAGG - Intergenic
1163307215 19:16488193-16488215 GCACTCTGGGAGCCAGAGGCGGG - Intronic
1163347128 19:16750235-16750257 GAACCCAGGGCGGCTGAGGCTGG + Exonic
1163685154 19:18708399-18708421 GAACCCAGGGTGCCCGAGAGAGG + Intronic
1163803166 19:19380223-19380245 GAACTTTGGGAGCCCGAGGCAGG - Intergenic
1164074833 19:21805217-21805239 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1164122719 19:22282864-22282886 GAACCCTGGGAGGCCGAGGCAGG + Intergenic
1165076730 19:33283488-33283510 GACCCCTGGTAGCCTGAGGCCGG + Intergenic
1165232402 19:34395280-34395302 GCACCTTGGGAGGCAGAGGCTGG + Intronic
1165618672 19:37225519-37225541 GAACAGTGGCTGCCAGGGGCTGG - Intronic
1165919169 19:39282609-39282631 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1166202577 19:41248168-41248190 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1166205395 19:41265581-41265603 GAGCCCTGGTGTCCAGAGGCTGG + Intronic
1166370321 19:42296685-42296707 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
1166413908 19:42577924-42577946 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1166420693 19:42633794-42633816 GAACCCAGGGTGCAAGAGAGTGG - Intronic
1166529141 19:43532366-43532388 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1166568664 19:43780166-43780188 GACCCCTGGAGGCCAGAGGGTGG - Intronic
1166622710 19:44316843-44316865 GATTGCTGGTTGCCAGAGGCTGG - Intergenic
1166769862 19:45275012-45275034 GCACCTTGGGTGGCCGAGGCGGG + Intronic
1166892808 19:46004184-46004206 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1166998722 19:46732465-46732487 GAACCCCGAGGTCCAGAGGCAGG - Intronic
1167404858 19:49299504-49299526 AAAGCCTGGGTGACAGAGGGAGG + Intronic
1167412916 19:49355578-49355600 GCACTCTGGGAGCCGGAGGCGGG + Intronic
1167616185 19:50535416-50535438 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1167767202 19:51491420-51491442 GAATGGTGGGTACCAGAGGCCGG + Exonic
1167894406 19:52569751-52569773 GGAGCCTGAGGGCCAGAGGCGGG - Intronic
1167986226 19:53319046-53319068 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
1168249101 19:55131231-55131253 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1168288121 19:55344522-55344544 GAACCCTGGTTGCCAGCTGCTGG + Intronic
1168391973 19:56016621-56016643 GAACAGTGGTTACCAGAGGCTGG - Intronic
1168394473 19:56036708-56036730 GAACTCTGGGAGGCTGAGGCAGG + Intronic
1168479343 19:56705773-56705795 GAATGCTGGTTACCAGAGGCTGG + Intergenic
1168509796 19:56965391-56965413 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1168599549 19:57706863-57706885 GAACTCTGGGTGGCTGAGGCGGG + Intronic
1202713703 1_KI270714v1_random:30787-30809 GCACCCTGGGAGAGAGAGGCAGG + Intergenic
924995251 2:354896-354918 GAACGATGGATACCAGAGGCTGG - Intergenic
925116053 2:1379056-1379078 GAACTCTGGGAGGCTGAGGCAGG + Intronic
925309529 2:2872591-2872613 GAATCCAGGCTGCCTGAGGCCGG - Intergenic
925340704 2:3133572-3133594 GAAGGGTGGGTGCCAGGGGCTGG + Intergenic
925915724 2:8604139-8604161 GATCAGTGGTTGCCAGAGGCTGG + Intergenic
926008655 2:9391829-9391851 GAACTCTGGGAGGCTGAGGCAGG - Intronic
926165574 2:10520812-10520834 GAACCCTGGGAGGCAGAGGCGGG + Intergenic
926247977 2:11134496-11134518 GAATGGTGGGTGCCAGAGGCTGG - Intronic
926251531 2:11157781-11157803 TGCCCCTGGGTGGCAGAGGCAGG - Intronic
926474535 2:13306206-13306228 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
927165520 2:20316783-20316805 GCACTCTGGGTGGCTGAGGCAGG + Intronic
927206002 2:20610973-20610995 GACCCATGGTTGCCAGGGGCTGG - Intronic
927621337 2:24663039-24663061 GAACTTTGGGAGACAGAGGCAGG - Intronic
927800523 2:26094803-26094825 GCACCTTGGGTGGCTGAGGCGGG - Intronic
927988325 2:27429006-27429028 GAACTCCGGCTGCGAGAGGCGGG + Intronic
927998406 2:27503052-27503074 GAACCCTCAGTACCAGAGGGAGG - Intronic
928017857 2:27675253-27675275 GAATGGTGGTTGCCAGAGGCTGG - Intronic
928288452 2:30015218-30015240 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
928547236 2:32339792-32339814 GAACGCTGGGAGGCCGAGGCGGG + Intergenic
928561660 2:32494653-32494675 GCACCCTGGGAGGCTGAGGCGGG + Intronic
928597809 2:32872749-32872771 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
928776391 2:34769104-34769126 GAATGATGGTTGCCAGAGGCTGG - Intergenic
929132802 2:38595028-38595050 GCACTCTGGGAGGCAGAGGCGGG + Intronic
929149965 2:38738692-38738714 GCACTCTGGGAGCCCGAGGCAGG + Intronic
929459656 2:42093501-42093523 GCACTCTGGGAGCCTGAGGCAGG + Intergenic
929968600 2:46553939-46553961 GAAGGATGGGTACCAGAGGCTGG - Intronic
930048875 2:47198355-47198377 GAAGCGTGGTTACCAGAGGCTGG + Intergenic
930146112 2:48006263-48006285 GAACCCTGGTTGGCTGAGGCAGG + Intergenic
930365942 2:50439558-50439580 GCACCCTGGGAGGCCGAGGCGGG + Intronic
930627226 2:53711266-53711288 GAACCCTGTGGGCCAGAGAATGG - Intronic
930825746 2:55695045-55695067 GCACGCTGGGAGGCAGAGGCGGG + Intergenic
931126109 2:59278641-59278663 GATCAGTGGTTGCCAGAGGCTGG - Intergenic
931299145 2:60959633-60959655 GCACTCTGGGTGGCTGAGGCGGG - Intronic
931326738 2:61233577-61233599 GCACTCTGGGAGGCAGAGGCAGG + Intronic
931485346 2:62684991-62685013 GAACAGTGGTTACCAGAGGCTGG + Intronic
931616692 2:64166368-64166390 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
931719677 2:65057900-65057922 GCACTCTGGGAGGCAGAGGCAGG - Intronic
931754527 2:65360648-65360670 GAACAGTGGTTGCCAGAGGCGGG + Intronic
931770257 2:65491161-65491183 GAACTCTGGGAGGCTGAGGCGGG + Intergenic
931940792 2:67249606-67249628 GAAGACTGGTTACCAGAGGCTGG - Intergenic
932490181 2:72115368-72115390 GAAGCCCAGGTGCCAGAGGCTGG + Intergenic
933084660 2:78040620-78040642 GCACCTTGGGAGGCAGAGGCGGG - Intergenic
933425263 2:82103250-82103272 GAACTCTGGGAGGCCGAGGCGGG - Intergenic
933600505 2:84324499-84324521 GAACCCTGAGTGTCAGAATCTGG - Intergenic
933753423 2:85618200-85618222 GCACTCTGGGAGGCAGAGGCAGG - Intronic
933762589 2:85682651-85682673 GCACCCTGGGAGGCGGAGGCGGG + Intergenic
933809522 2:86024332-86024354 GAACAGTGGTTGCCAGGGGCTGG + Exonic
934529285 2:95075120-95075142 CATCCCTGGGTCCCAGAGGCAGG + Intergenic
934915373 2:98297326-98297348 GAACCTTGGGAGGCTGAGGCAGG - Intronic
935112609 2:100105971-100105993 AAACCCTGGGTGCAAGTGACGGG + Intronic
935397533 2:102623462-102623484 GAACCCTGGGAGCAAGAGGAGGG - Intronic
935461313 2:103338335-103338357 GAATGATGGTTGCCAGAGGCTGG + Intergenic
935560335 2:104552447-104552469 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
935637082 2:105257429-105257451 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
935852731 2:107240597-107240619 GAACCCTGTGTGCTATTGGCAGG + Intergenic
935875836 2:107506137-107506159 GAACTCTGGGAGCCAGAGGCAGG + Intergenic
936063823 2:109315692-109315714 GAACCCTGGGTGGGAAAGCCTGG - Intronic
936067107 2:109340605-109340627 GGACCCTGGGTGCCGGGGCCAGG - Intronic
936071124 2:109371978-109372000 GAAGCATGGGTGCCAGGCGCAGG - Intronic
936104031 2:109609486-109609508 GCAGCCTGGCTGCCAGGGGCTGG + Intronic
936360066 2:111790891-111790913 GAATGGTGGCTGCCAGAGGCTGG + Intronic
936459240 2:112700007-112700029 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
936596016 2:113848786-113848808 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
937160879 2:119759998-119760020 GACTCCTGGGTCCCAGGGGCCGG + Exonic
937192789 2:120120867-120120889 GCACCCTGGGAGGCCGAGGCGGG + Intronic
937316055 2:120932804-120932826 GGAGACTGGGTGGCAGAGGCCGG + Intronic
937375379 2:121332657-121332679 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
937422738 2:121772020-121772042 GAATTTTGGGTGCCTGAGGCTGG + Intergenic
937744040 2:125389538-125389560 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
937875442 2:126822036-126822058 GAACAGTGGCTACCAGAGGCTGG + Intergenic
937895650 2:126975016-126975038 GAACTCTGGGAGGCCGAGGCAGG + Intergenic
938153032 2:128902882-128902904 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
938253002 2:129830541-129830563 GAACACTGGTTACCAGAGACGGG + Intergenic
938401320 2:130994024-130994046 GCACTTTGGGAGCCAGAGGCAGG - Intronic
938455286 2:131457694-131457716 GAACTTTGGGTGGCTGAGGCAGG - Intergenic
938471283 2:131564725-131564747 CAACAGTGGGTACCAGAGGCTGG - Intergenic
938528719 2:132162225-132162247 GGTCCCTGGCTGCAAGAGGCCGG - Intronic
938859637 2:135354746-135354768 GATCCGTGGTTGCCAGGGGCTGG + Intronic
939363926 2:141208619-141208641 GAACTCTGGGAGGCGGAGGCAGG + Intronic
940132681 2:150401449-150401471 GCACTCTGGGAGCCAGAGGCAGG + Intergenic
940459234 2:153941240-153941262 GAACTCTGGGAGGCTGAGGCGGG - Intronic
940541947 2:155031321-155031343 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
940592368 2:155746075-155746097 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
940690714 2:156916320-156916342 GAACATTGTTTGCCAGAGGCTGG - Intergenic
940780587 2:157929537-157929559 GAACTTTGGGAGGCAGAGGCAGG - Intronic
941525469 2:166601377-166601399 GAATGCTGGATACCAGAGGCTGG + Intergenic
941542508 2:166804261-166804283 GAGCCCAGGCTGCCAGGGGCAGG + Intergenic
941595129 2:167466972-167466994 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
941792157 2:169564731-169564753 GAACGATGGTTACCAGAGGCTGG - Intronic
941826003 2:169897745-169897767 GCACTCTGGGTGGCTGAGGCAGG - Intronic
942114135 2:172711616-172711638 GAACTTTGGGAGGCAGAGGCTGG + Intergenic
942395621 2:175545470-175545492 GAAACATGGTTACCAGAGGCTGG + Intergenic
942468738 2:176237478-176237500 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
942725415 2:179001622-179001644 GAACCTTGGGGGGCACAGGCAGG + Intronic
942813804 2:180027673-180027695 GAAGGCTGGTTACCAGAGGCTGG - Intergenic
942876948 2:180811984-180812006 GAATGATGGGTACCAGAGGCTGG - Intergenic
943081742 2:183265014-183265036 GCACCCTGGGAGGCTGAGGCGGG - Intergenic
943191682 2:184685762-184685784 GAAGCCTGGGGGCCTGAAGCGGG - Intronic
943449571 2:188031326-188031348 GAACTCTGGGAGGCTGAGGCGGG - Intergenic
943583809 2:189714698-189714720 GAACCTTGGGAGGCTGAGGCGGG + Intronic
943609984 2:190020763-190020785 GAACAGTGGCTGCCAGGGGCTGG - Intronic
943652146 2:190468703-190468725 GCACCCTGGGAGGCTGAGGCAGG - Intronic
944707686 2:202307842-202307864 GAAGCCTGGGGACCCGAGGCTGG + Intergenic
945364391 2:208933552-208933574 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
945432294 2:209778154-209778176 GAACTTTGGGAGGCAGAGGCAGG + Intronic
945843318 2:214914113-214914135 GCACTGTGGGTGGCAGAGGCGGG - Intergenic
946040496 2:216779147-216779169 GAACGATGGTTACCAGAGGCTGG - Intergenic
946107516 2:217384829-217384851 GATCAATGGTTGCCAGAGGCTGG - Intronic
946199312 2:218062464-218062486 GCACTCTGGGAGACAGAGGCAGG + Intronic
946301862 2:218828696-218828718 GAACCCTGGGTGGGACAGGGAGG - Intronic
946453859 2:219804817-219804839 GAACTTTGGGTGGCCGAGGCAGG - Intergenic
946737760 2:222771753-222771775 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
947059712 2:226149841-226149863 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
947285087 2:228505507-228505529 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
947419484 2:229929315-229929337 GAACTTTGGGAGCCTGAGGCAGG + Intronic
947629420 2:231642382-231642404 GTACCTTGGGTGGCCGAGGCGGG - Intergenic
947833528 2:233159026-233159048 GCACTTTGGGTGACAGAGGCGGG - Intronic
947935094 2:233997678-233997700 GACCCCTGGAAACCAGAGGCTGG - Intronic
948188171 2:236037652-236037674 GGACTCTGGGTGTCTGAGGCAGG - Intronic
948267137 2:236643187-236643209 GAAATCTGGCAGCCAGAGGCTGG - Intergenic
948412316 2:237773675-237773697 GGGCCCAGGGTGCTAGAGGCAGG - Intronic
948422569 2:237869462-237869484 GAATCGTGGGTCCCAGGGGCTGG - Intronic
948503715 2:238413247-238413269 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
948582147 2:238995640-238995662 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
948626415 2:239271649-239271671 AAAGCCTGGGTGGCTGAGGCCGG + Intronic
948796353 2:240404279-240404301 GCACCCTGGGTGACCGAGGCAGG + Intergenic
948832396 2:240604457-240604479 GGCCCCTGGGTGACACAGGCAGG - Intronic
948940438 2:241192890-241192912 GAATGGTGGGTGCCAGGGGCTGG + Intronic
948969425 2:241413694-241413716 GCACCCTGGGAGGCTGAGGCAGG + Intronic
948969930 2:241417567-241417589 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1169051154 20:2578973-2578995 GAGCCCAGGCTGCCAGAGGCAGG - Intronic
1169101365 20:2952734-2952756 GAACGATGGTTGCCAGGGGCTGG - Intronic
1169341886 20:4802662-4802684 GAACGGTGGTTGCCAGAGGCTGG + Intronic
1169649411 20:7850261-7850283 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1169972524 20:11283751-11283773 GAACGATGGTTGCCAGGGGCTGG + Intergenic
1170379209 20:15738028-15738050 GAACGATGGTTACCAGAGGCTGG + Intronic
1170511176 20:17078341-17078363 GAACAATGGTTACCAGAGGCTGG - Intergenic
1170601713 20:17846400-17846422 GAAGCCTGGAGGGCAGAGGCGGG - Intergenic
1170638386 20:18129421-18129443 GAACTTTGGGAGCCAGAGGCGGG - Intergenic
1170700282 20:18696984-18697006 GGACTTTGGGTGGCAGAGGCGGG + Intronic
1170868993 20:20187317-20187339 GGGCCCAGGGTGCCAGGGGCAGG + Intronic
1170991965 20:21310995-21311017 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1171005222 20:21458094-21458116 GAACTCTGGGAGACTGAGGCAGG - Intergenic
1171024927 20:21621586-21621608 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1171289787 20:23975819-23975841 GCACACTGGGAGCCTGAGGCAGG - Intergenic
1171350458 20:24498524-24498546 GAATGGTGGCTGCCAGAGGCAGG - Intronic
1171440177 20:25154236-25154258 GATTCGTGGTTGCCAGAGGCTGG - Intergenic
1171544881 20:25992243-25992265 GTGCCCTGTGTGCCAGAGGGCGG + Intergenic
1172119269 20:32588265-32588287 GAGCCCTTGGGGCAAGAGGCTGG - Intronic
1172161934 20:32874993-32875015 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1172247876 20:33458341-33458363 GCACACTGGGAGCCTGAGGCAGG + Intergenic
1172423247 20:34835723-34835745 GCACTCTGGGTGGCAGAGGTGGG - Intergenic
1172539743 20:35701840-35701862 GAACACTGGGAGGCGGAGGCGGG - Intergenic
1172650996 20:36501310-36501332 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1172768071 20:37361586-37361608 GAACAGTGGGTGCCATGGGCAGG + Intronic
1173083567 20:39892760-39892782 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1173147789 20:40539866-40539888 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1173382312 20:42557059-42557081 CAACCCAGTGTGGCAGAGGCAGG + Intronic
1173405023 20:42757018-42757040 CTACCCTGGGTGACAGAGGAAGG + Intronic
1174027287 20:47588379-47588401 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1174096882 20:48096780-48096802 GAGCCCTGGGAGGCCGAGGCGGG + Intergenic
1174288817 20:49492306-49492328 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1174400804 20:50274913-50274935 GAACCCTGGGTGCCTGAGTCAGG + Intergenic
1174615789 20:51834385-51834407 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
1174626008 20:51914881-51914903 GAACCCTGGCTGAAAGAGCCAGG + Intergenic
1175198152 20:57260345-57260367 GGACCCTGGATTCCAGATGCAGG - Intronic
1175463887 20:59176291-59176313 GATCTGTGGTTGCCAGAGGCTGG + Intergenic
1175674765 20:60937001-60937023 GACCCCCTGGTGCCAGATGCTGG - Intergenic
1175815427 20:61880964-61880986 GGACCCTGGATGGCAGAGGAGGG + Intronic
1175827000 20:61941863-61941885 GAGGCCTGGGTGCCAGGGGACGG + Intergenic
1175845459 20:62055988-62056010 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1175883076 20:62271696-62271718 GCACCCTGGGAGGCCGAGGCGGG - Intronic
1175954980 20:62604592-62604614 GAAGCCTTGGGGCCAGAGCCTGG + Intergenic
1175975311 20:62707936-62707958 CAGCCCAGGGTGCCAGATGCAGG + Intergenic
1176213521 20:63937603-63937625 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
1176225629 20:63997145-63997167 GAACGGTGGATGCCAGGGGCTGG - Intronic
1176737057 21:10559625-10559647 GCACCCTGGGAGGCCGAGGCGGG + Intronic
1176874144 21:14110646-14110668 GAACCATGGTTACCAGAGGCTGG - Intronic
1177017454 21:15809969-15809991 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1177438068 21:21081989-21082011 GCACCTTGGGAGGCAGAGGCGGG + Intronic
1177455662 21:21334177-21334199 GCACCTTGGGAGGCAGAGGCCGG - Intronic
1177653684 21:23988588-23988610 GAACCTTGGGAGGCCGAGGCAGG - Intergenic
1177830720 21:26135885-26135907 GCACGCTGGGTGGCCGAGGCAGG + Intronic
1178286617 21:31330682-31330704 GAACCTTGGGAGGCTGAGGCAGG - Intronic
1178321686 21:31610819-31610841 GCACCTTGGGAGGCAGAGGCAGG - Intergenic
1178686383 21:34714439-34714461 GAACTTTGGGTGGCTGAGGCGGG + Intronic
1178825325 21:36011037-36011059 GAAAGGTGGTTGCCAGAGGCTGG - Intergenic
1179181141 21:39046271-39046293 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
1179505522 21:41837511-41837533 GAATGGTGGGTGCCAGGGGCTGG + Intronic
1179506652 21:41845509-41845531 GTAATCTGGGTGGCAGAGGCCGG + Intronic
1179549464 21:42134868-42134890 GAACCTTGGGAGGCTGAGGCGGG - Intronic
1179586013 21:42374553-42374575 GACTGGTGGGTGCCAGAGGCTGG + Intronic
1179782827 21:43713332-43713354 GAACTTTGGGTGGCTGAGGCAGG - Intergenic
1179884053 21:44305972-44305994 GTTCCCTGGGTGGCTGAGGCCGG + Intronic
1179906144 21:44424304-44424326 GACCCCTGGGTGCAACGGGCAGG - Intronic
1179909185 21:44438938-44438960 CAGCCCTGGGAGCCACAGGCAGG - Intronic
1180030790 21:45205563-45205585 GAACCAGGGGTGCCAATGGCAGG + Intronic
1180075743 21:45460569-45460591 GACACCTGTGTGCCAGTGGCTGG - Intronic
1180134636 21:45854427-45854449 GGATCCTGGGTGCCAGAGGCTGG - Intronic
1180217980 21:46338318-46338340 GACCACTGGTTGCCAGAGGCTGG - Intronic
1180690594 22:17711542-17711564 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1180694895 22:17745412-17745434 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1180925390 22:19550223-19550245 GAACTTTGGGAGCCTGAGGCGGG - Intergenic
1180936419 22:19628145-19628167 GAATCGTGGTTGCCAGGGGCTGG - Intergenic
1180937572 22:19636188-19636210 GAACGGTGGTTGCCAGGGGCTGG + Intergenic
1180977330 22:19855476-19855498 GCAGGCTGGGCGCCAGAGGCAGG + Intergenic
1181219610 22:21358459-21358481 GAGCCCTGGGCGGCAGAGGGAGG - Intergenic
1181584153 22:23843877-23843899 GAACCCTGGGAGGCCAAGGCCGG + Intergenic
1181680151 22:24489797-24489819 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1181683488 22:24512692-24512714 GAACGGTGGTTGCCAGGGGCTGG - Intronic
1182002284 22:26929600-26929622 GAATGGTGGCTGCCAGAGGCTGG - Intergenic
1182146952 22:28002371-28002393 CAACACTGGGTGCCAGGGGTGGG + Intronic
1182209017 22:28658508-28658530 GAATGGTGGCTGCCAGAGGCTGG + Intronic
1182348632 22:29685352-29685374 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1182477868 22:30586208-30586230 TAACACTGTGTGCCACAGGCAGG + Intronic
1182483276 22:30623496-30623518 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1182495054 22:30700837-30700859 GAACTCTGGGAGGCTGAGGCGGG + Intronic
1182598219 22:31438964-31438986 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1182817947 22:33183827-33183849 GAACGGTGGTTGTCAGAGGCTGG + Intronic
1183170583 22:36184809-36184831 GAGCCCTGGATGCCAGAGTGGGG + Intergenic
1183425527 22:37737159-37737181 GCATGCTGGGTGCCACAGGCCGG + Intronic
1183508561 22:38222330-38222352 GAATCCTGGGTTCCAGGGGTGGG - Intronic
1183525789 22:38321688-38321710 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1183541669 22:38432720-38432742 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1183659571 22:39211078-39211100 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1183911889 22:41086051-41086073 GAACAGTGGTTGCCAGGGGCTGG - Intergenic
1183986657 22:41573975-41573997 GAAGCCTGGGAGCCAGCGGCTGG + Intronic
1184149881 22:42631718-42631740 GAACCCAGGGTCCCAAAGGGAGG + Intronic
1184210580 22:43033113-43033135 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
1184667800 22:45997732-45997754 GGAACCTGGGGGACAGAGGCTGG + Intergenic
1184710978 22:46249400-46249422 GCACTCTGGTAGCCAGAGGCGGG + Intronic
1184773390 22:46610966-46610988 GCACTTTGGGTGGCAGAGGCTGG + Intronic
1184840570 22:47050249-47050271 GCACCCTGGGGGGCCGAGGCGGG - Intronic
1185247662 22:49781616-49781638 GCAGCTTGGGTGCCAGCGGCAGG - Intronic
1185254826 22:49826524-49826546 GAGCCCTGCGGGCCACAGGCGGG + Intronic
1185412966 22:50695535-50695557 GAGGCCTGGGTCCCTGAGGCAGG + Intergenic
949313397 3:2725279-2725301 GCACCCTGGGTTACAGATGCAGG - Intronic
949702765 3:6778357-6778379 GAACTTTGGGAGGCAGAGGCAGG + Intronic
949902781 3:8832773-8832795 GAACTTTGGGAGGCAGAGGCTGG + Intronic
950106072 3:10389577-10389599 GAATGGTGGGTGCCAGGGGCTGG + Intronic
950140081 3:10609297-10609319 GAACTCTGGCTGCCAGCAGCAGG + Intronic
950174515 3:10863497-10863519 GCACACAGAGTGCCAGAGGCTGG + Intronic
950341962 3:12255139-12255161 GAACAGTGGTTGCCAGGGGCAGG - Intergenic
950451058 3:13066054-13066076 GAATGGTGGGTGCCAGGGGCTGG + Intronic
950553991 3:13684360-13684382 ACACCCTGGGAGCCAGAGGTGGG + Intergenic
950578583 3:13847780-13847802 GAAAGGTGGGTGCCAGGGGCTGG + Intronic
950859205 3:16132610-16132632 GAACACTGGATGCCTGAGGATGG + Intergenic
951582146 3:24176765-24176787 GAAAAATGGTTGCCAGAGGCTGG + Intronic
952102591 3:30032073-30032095 GAACGGTGGTTACCAGAGGCTGG - Intergenic
952303793 3:32127545-32127567 GGAGCTTGGGGGCCAGAGGCCGG + Intronic
952323172 3:32296774-32296796 AAAACCTGGGTGAGAGAGGCAGG - Intronic
952391280 3:32882786-32882808 GCACTCTGGGAGGCAGAGGCAGG - Intronic
952672200 3:35983538-35983560 CCACTCTGGGTGACAGAGGCAGG - Intergenic
952790122 3:37193753-37193775 GAAACCTGGGGGGCTGAGGCAGG - Intergenic
953261918 3:41347959-41347981 GCACCTTGGGAGCCTGAGGCAGG + Intronic
953548175 3:43879830-43879852 GATCACTGGTTGCCAGAAGCTGG + Intergenic
953551496 3:43907065-43907087 GAAGGCTGGCTGCCAGAGGAAGG - Intergenic
953762008 3:45695839-45695861 GAACGGTGGTTGCCAGGGGCTGG - Intronic
954112365 3:48441427-48441449 GCACTCTGGGAGGCAGAGGCGGG - Intronic
954129080 3:48550600-48550622 GATTCCTGGATGACAGAGGCAGG - Intronic
954133511 3:48571641-48571663 GAACGCTGGCAGCCAGGGGCAGG + Intronic
954158381 3:48701318-48701340 GCACCCTGGGAGGCTGAGGCGGG + Intronic
954228232 3:49196914-49196936 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
954241548 3:49297729-49297751 GACCCCTGGGTGCAAGAGATGGG - Intronic
954365225 3:50142321-50142343 GCACTCTGGGTGGCCGAGGCAGG - Intergenic
954453804 3:50586159-50586181 GGGCCCTGGGGGGCAGAGGCTGG - Intergenic
954791402 3:53135984-53136006 AGACCCTGGGTCCCAGGGGCTGG - Intergenic
955153526 3:56392867-56392889 CCACACTGGGTGCCACAGGCAGG + Intronic
955215728 3:56983689-56983711 GCACTTTGGGAGCCAGAGGCGGG + Intronic
955354162 3:58216644-58216666 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
955913858 3:63886223-63886245 GAATAATGGTTGCCAGAGGCTGG + Intronic
956949846 3:74269836-74269858 AAATGCTGGTTGCCAGAGGCTGG + Intronic
956957148 3:74353960-74353982 GATCACTGCTTGCCAGAGGCTGG - Intronic
957051704 3:75416604-75416626 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
957126079 3:76162557-76162579 GAACCTTGGGAGGCTGAGGCAGG - Intronic
957450585 3:80377074-80377096 GAACCCAGGATGCCAGAAGGCGG - Intergenic
958153486 3:89722349-89722371 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
958530136 3:95318166-95318188 GAATGGTGGATGCCAGAGGCTGG + Intergenic
959053968 3:101550974-101550996 GAATCATGGGAGCCCGAGGCAGG - Intergenic
959304410 3:104642431-104642453 GAAGGATGGGTGTCAGAGGCTGG + Intergenic
959354902 3:105313496-105313518 GAACAGTGGCTACCAGAGGCAGG + Intergenic
960089550 3:113625383-113625405 GGACCATGGGAGGCAGAGGCAGG - Intronic
960315318 3:116168952-116168974 GTACCCTGGGAGGCTGAGGCAGG + Intronic
961302772 3:125932990-125933012 GAACTCTGGGAGCCCGCGGCAGG - Intronic
961380782 3:126495317-126495339 GAATGGTGGGTGCCAGGGGCTGG - Intronic
961460702 3:127048400-127048422 GAACACTGGTTGTCAGGGGCTGG - Intergenic
961469778 3:127104311-127104333 GAAGAGTGGGTGCCAGGGGCTGG - Intergenic
961597463 3:128029883-128029905 GAAGGTTGGTTGCCAGAGGCTGG - Intergenic
961674267 3:128555366-128555388 GCACCCTGGCCGCCCGAGGCAGG - Intergenic
961706229 3:128787958-128787980 GAACTCTGGGAGGCTGAGGCAGG - Intronic
961809365 3:129513071-129513093 GGACCCTGGGTGGGAGGGGCCGG + Intronic
961845899 3:129762750-129762772 GCACCCTGGGTGACAGAGTAAGG + Intronic
961885295 3:130092782-130092804 GAACTCTGGGAGGCCGAGGCAGG + Intronic
962201239 3:133402887-133402909 GCACTCTGGGAGGCAGAGGCGGG - Intronic
962332908 3:134495745-134495767 GAACGATGGTTACCAGAGGCTGG - Intronic
962489627 3:135880796-135880818 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
962518641 3:136177426-136177448 GCACCCTGGGAGGCTGAGGCAGG + Intronic
962521708 3:136203118-136203140 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
962542084 3:136392734-136392756 CCACCCTGGGTGACAGAGCCAGG + Intronic
962566645 3:136667299-136667321 GCATTCTGGGTGGCAGAGGCAGG + Intronic
962682683 3:137816011-137816033 GCAGCAGGGGTGCCAGAGGCAGG - Intergenic
962872718 3:139512067-139512089 GCACCATGGGTACGAGAGGCTGG + Intergenic
963590696 3:147254353-147254375 GAACCCTGGAAGTCAGAGTCAGG - Intergenic
963880957 3:150527676-150527698 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
963934847 3:151041919-151041941 GCACTCTGGGAGCCCGAGGCGGG - Intergenic
963991528 3:151661729-151661751 GCACCCTGGGAGGCGGAGGCAGG - Intergenic
964108925 3:153068943-153068965 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
964859338 3:161183770-161183792 GAATACTGGTTGCCAGAGGTTGG + Intronic
965005066 3:163010739-163010761 GAATCATGGTTGCCAGAGGCTGG + Intergenic
965160245 3:165123941-165123963 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
965597202 3:170420796-170420818 GAGTCCTGGATGCCGGAGGCTGG - Intronic
965714974 3:171593347-171593369 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
965757916 3:172043161-172043183 GCACTCTGGGAGCCCGAGGCGGG - Intronic
966094268 3:176179796-176179818 GAAGCATGGTTACCAGAGGCTGG + Intergenic
966814285 3:183876963-183876985 GTACCCTGGGAGGCCGAGGCGGG + Intronic
966814888 3:183881952-183881974 CAACACTGGGAGGCAGAGGCAGG + Intronic
967058808 3:185853400-185853422 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
967064279 3:185900895-185900917 GCACCCTGGGAGGCCGAGGCGGG - Intergenic
967075896 3:186001540-186001562 GAACAAAGGTTGCCAGAGGCTGG - Intergenic
967309938 3:188096227-188096249 GATCCCTGGGTGCCAGTCCCGGG - Intergenic
967483015 3:189996431-189996453 GAACGGTGATTGCCAGAGGCTGG + Intronic
968095848 3:195930243-195930265 GAACTTTGGGAGACAGAGGCAGG - Intergenic
968127995 3:196174312-196174334 GAACTCTGGGGGGCTGAGGCAGG + Intergenic
968145409 3:196294103-196294125 GAACTCTGGGAGGCCGAGGCGGG + Intronic
968165819 3:196464440-196464462 GAACACTGGGAGGCCGAGGCGGG - Intergenic
968443001 4:634014-634036 ACCCCCTGGGAGCCAGAGGCAGG + Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
968596406 4:1488310-1488332 GCACCTTGGGAGCCTGAGGCAGG - Intergenic
968693739 4:2009877-2009899 GCACTCTGGGAGGCAGAGGCGGG - Exonic
968771242 4:2508856-2508878 GCACTCTGGGAGGCAGAGGCGGG - Intronic
968790660 4:2658995-2659017 GCACCTTGGGAGGCAGAGGCAGG - Intronic
968800543 4:2740661-2740683 GCACGCTGGGAGGCAGAGGCAGG + Intergenic
968885728 4:3330776-3330798 GCACCCTGGGTTCCTGAGGAGGG - Intronic
968994485 4:3936984-3937006 GAACTCTGGGAGGCCGAGGCAGG + Intergenic
969037593 4:4267299-4267321 GAACTTTGGGTGGCCGAGGCAGG + Intergenic
969153817 4:5192880-5192902 GAACGGAGGGTGCCAGGGGCTGG - Intronic
969491878 4:7504089-7504111 GCAGCCTGGGTGCCAGGGGTAGG + Intronic
969783966 4:9437407-9437429 GAACAGTGGTTACCAGAGGCTGG + Intergenic
969819451 4:9709252-9709274 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
970008309 4:11430665-11430687 GCACCCTGGAAGCCAAAGGCAGG + Intergenic
970034144 4:11712889-11712911 GAACTTTGGGAGCCCGAGGCGGG + Intergenic
970445987 4:16123702-16123724 CACCTCTGGGAGCCAGAGGCTGG + Intergenic
970569260 4:17363708-17363730 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
970641622 4:18072726-18072748 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
971011296 4:22438747-22438769 GCACTCTGGGAGACAGAGGCGGG + Intronic
971026272 4:22591344-22591366 GGATCCAGGGTGGCAGAGGCAGG - Intergenic
971345683 4:25810024-25810046 GGAGCCTGGGGGCAAGAGGCAGG + Intronic
971467910 4:26984609-26984631 GCACTTTGGGAGCCAGAGGCGGG - Intronic
971825303 4:31614075-31614097 CAACCTTGGGTGCCAGAGTCTGG + Intergenic
971909614 4:32778621-32778643 GCACTTTGGGAGCCAGAGGCTGG - Intergenic
972408160 4:38766095-38766117 TTGCCCTGGGTGCCCGAGGCTGG + Intergenic
972436054 4:39036547-39036569 GATCAGTGGTTGCCAGAGGCTGG + Intergenic
972698374 4:41469924-41469946 GCACCTTGGGAGGCAGAGGCAGG - Intronic
972760656 4:42100189-42100211 GAACCTTGGTTATCAGAGGCTGG - Intergenic
972769956 4:42188536-42188558 GAATCATGGTTACCAGAGGCTGG + Intergenic
973744909 4:53954638-53954660 GAATTCTGGGAGGCAGAGGCAGG + Intronic
974063095 4:57053261-57053283 GCACCCTGGGAGCCCGAAGCGGG - Intronic
975107759 4:70587879-70587901 GAATAGTGGTTGCCAGAGGCTGG + Intergenic
975463675 4:74685199-74685221 GAATTTTGGTTGCCAGAGGCTGG + Intergenic
975517450 4:75262094-75262116 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
976071812 4:81249707-81249729 GAACAATGGTTGCCAGGGGCTGG + Intergenic
976422555 4:84862874-84862896 GAATGGTGGGTGCCAGGGGCTGG - Intronic
976902647 4:90197760-90197782 GAAGGATGGGTACCAGAGGCTGG + Intronic
977209852 4:94206471-94206493 GAACGATGGCTACCAGAGGCTGG + Intergenic
977401198 4:96534760-96534782 GCACTTTGGGTGGCAGAGGCAGG + Intergenic
977612788 4:99053497-99053519 GCACTCTGGGAGGCAGAGGCGGG - Intronic
977628495 4:99215591-99215613 GCACTCTGGGAGGCAGAGGCAGG - Intronic
977752036 4:100621071-100621093 GAACTTTGGGAGGCAGAGGCGGG - Intronic
977762451 4:100755759-100755781 GAAGGATGGGTACCAGAGGCTGG + Intronic
978003144 4:103581630-103581652 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
978221996 4:106288145-106288167 GAACTCTGGGAGGCCGAGGCAGG + Intronic
978442399 4:108747544-108747566 GCACCTTGGGAGGCAGAGGCAGG - Intronic
978709096 4:111755734-111755756 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
978734072 4:112065362-112065384 GAACGATGGTTACCAGAGGCTGG + Intergenic
978762372 4:112367979-112368001 TAAACCTGGGAGCCAGAGGTTGG - Intronic
979474294 4:121136596-121136618 GCACTTTGGGAGCCAGAGGCAGG + Intronic
979586296 4:122422369-122422391 GAACTCTGGGAGGCTGAGGCGGG - Intronic
979882826 4:125984312-125984334 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
980533053 4:134079214-134079236 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
980942594 4:139288649-139288671 GAACTCTGGGAGGCAGAGGCAGG + Intronic
981562708 4:146065035-146065057 GAACCATGGTTGCCAGGGGCTGG + Intergenic
981818213 4:148855551-148855573 GAACACTGGGAGGCTGAGGCAGG - Intergenic
981992813 4:150943365-150943387 GAAACCTGGGAGGCTGAGGCAGG - Intronic
982354928 4:154455841-154455863 GAACTTTGGGAGGCAGAGGCAGG + Intronic
982361168 4:154520657-154520679 GCACTCTGGGTGGCCGAGGCAGG - Intergenic
982372028 4:154644172-154644194 GCACCTTGGGTGGCCGAGGCAGG - Intronic
982503099 4:156184171-156184193 GAATGCTGGTTGCCAGGGGCTGG - Intergenic
982711055 4:158759269-158759291 GAATCATGGGAGCCCGAGGCAGG - Intergenic
982748793 4:159134149-159134171 GATCACTGGTTGCCAGAGACAGG - Intronic
983119958 4:163870809-163870831 GAATAGTGGTTGCCAGAGGCAGG + Intronic
983289154 4:165779535-165779557 GCACTCTGGGTGGCTGAGGCGGG - Intergenic
983436766 4:167725150-167725172 TAACCCTGAGTGCCAGAAGTGGG - Intergenic
983440318 4:167774267-167774289 GAATGCTGGTTTCCAGAGGCTGG + Intergenic
983621217 4:169762890-169762912 GAATGCTGGTTACCAGAGGCTGG - Intergenic
984212453 4:176867292-176867314 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
984522174 4:180814938-180814960 GAACAATGGTTACCAGAGGCTGG - Intergenic
984978312 4:185251410-185251432 GAACAGTGGTTACCAGAGGCTGG - Intronic
985050294 4:185983980-185984002 GAACTTTGGGAGCCCGAGGCTGG - Intergenic
985155039 4:186978697-186978719 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
985287560 4:188351872-188351894 GAACGGTGGTTACCAGAGGCTGG - Intergenic
986188871 5:5474687-5474709 GAACCCTGGCTGAGAAAGGCTGG + Intronic
986303083 5:6493896-6493918 TCACCCTGGGCTCCAGAGGCAGG - Exonic
986374151 5:7113343-7113365 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
986738966 5:10689214-10689236 GTGCCCTGGGAGTCAGAGGCTGG - Intronic
987496070 5:18646299-18646321 GAAAGATGGTTGCCAGAGGCAGG - Intergenic
987631945 5:20484777-20484799 GAACGATGGTTACCAGAGGCTGG + Intronic
987800346 5:22687659-22687681 GAACTCTGGGAGGCTGAGGCAGG - Intronic
987814366 5:22881426-22881448 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
988115017 5:26875711-26875733 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
988171377 5:27661039-27661061 GAAGCATGGTTACCAGAGGCTGG - Intergenic
988274242 5:29059802-29059824 GAACTCTGGGTGGCCGAGGTGGG - Intergenic
988376690 5:30444513-30444535 GAATGATGGGTACCAGAGGCTGG + Intergenic
988480529 5:31626653-31626675 GAACCCATGCTTCCAGAGGCTGG - Intergenic
988486761 5:31673722-31673744 GCACTCTGGGAGGCAGAGGCAGG + Intronic
988654849 5:33198664-33198686 GAATGCTGGTTACCAGAGGCTGG - Intergenic
988979963 5:36557638-36557660 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
989443509 5:41501510-41501532 GAATGCTGGTTGCCAGAGGCTGG + Intronic
990036381 5:51325779-51325801 GAGCCTTGGCTGCCAGAAGCTGG - Intergenic
990310273 5:54531102-54531124 GCACCCTGGCTCCCTGAGGCAGG + Intronic
990454908 5:55975612-55975634 GAACCTTGGGAGGCATAGGCAGG - Intronic
990505408 5:56439228-56439250 GAACCCTGGGAGGCCGAGGTGGG - Intergenic
990550299 5:56869282-56869304 GAATGGTGGTTGCCAGAGGCTGG + Intronic
991049538 5:62257903-62257925 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
991063782 5:62404432-62404454 GCACTCTGGGAGGCAGAGGCGGG + Intronic
991091237 5:62695940-62695962 GAACTTTGGGAGCCCGAGGCAGG - Intergenic
991510649 5:67373151-67373173 GAATAGTGGTTGCCAGAGGCTGG - Intergenic
992412148 5:76516119-76516141 GAACTCTGGGAGGCTGAGGCGGG - Intronic
992540609 5:77760508-77760530 GAATCATGGGAGCCCGAGGCCGG - Intronic
992802727 5:80308529-80308551 GCTCCTTGGGTGACAGAGGCTGG + Intergenic
992822254 5:80509223-80509245 GCACTTTGGGAGCCAGAGGCAGG - Intronic
992881692 5:81116698-81116720 GAAAGCTGGTTGCCAGGGGCCGG - Intronic
992895053 5:81238671-81238693 GAGCCATGAGTGGCAGAGGCAGG - Intronic
993238444 5:85346677-85346699 GACCCCTGGGTTCCAGATGAGGG - Intergenic
993321265 5:86470535-86470557 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
993886720 5:93423421-93423443 GAACCATGGGTGGCAGAGGCAGG + Intergenic
994473637 5:100240079-100240101 GCACCCTGGGAGGCAGAGGCAGG - Intergenic
994517068 5:100785255-100785277 GAATCATGGGAGCCCGAGGCAGG - Intergenic
995001459 5:107135948-107135970 GAACTCTGGGAGGCCGAGGCAGG + Intergenic
995102919 5:108337009-108337031 GAACTCTGGGAGGCCGAGGCAGG + Intronic
995735171 5:115293151-115293173 GAACAATAGTTGCCAGAGGCTGG + Intronic
995912374 5:117203153-117203175 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
996173880 5:120331366-120331388 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
996373803 5:122781186-122781208 GATCAGTGGTTGCCAGAGGCTGG - Intronic
996395788 5:123012479-123012501 GAACTTTGGTTGACAGAGGCTGG + Intronic
996465421 5:123796427-123796449 GAACTCTGGGAGGCCGAGGCAGG + Intergenic
996626808 5:125580011-125580033 GCAGCCTGGGTGACAGAGCCAGG - Intergenic
996999543 5:129743126-129743148 GAACAGAGGTTGCCAGAGGCTGG + Intergenic
997014970 5:129922005-129922027 GAATGATGGTTGCCAGAGGCTGG - Intronic
997086098 5:130801460-130801482 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
997291983 5:132743531-132743553 GCACTCTGGGAGACAGAGGCAGG + Intergenic
997300364 5:132799180-132799202 GAACTCTGGGAGGCTGAGGCAGG + Intronic
997308309 5:132857117-132857139 GCACTTTGGGAGCCAGAGGCAGG - Intergenic
997369671 5:133350444-133350466 CAACCCTGAGAGCCTGAGGCTGG - Intronic
997433673 5:133858587-133858609 GCACCTTGGGAGGCAGAGGCGGG + Intergenic
997644943 5:135475764-135475786 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
997694654 5:135851637-135851659 GTACCCTGGCTGCCAGAGGCAGG - Intronic
997925915 5:138031439-138031461 GAACTCTGGGAGGCTGAGGCAGG + Intronic
997959911 5:138312664-138312686 GAATGGTGGTTGCCAGAGGCTGG + Intronic
998030062 5:138858843-138858865 GCACCCTGGGAGGCCGAGGCAGG - Intronic
998110790 5:139500983-139501005 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
998251102 5:140553227-140553249 GCACACTGGGAGGCAGAGGCAGG + Intronic
998493217 5:142564991-142565013 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
998572065 5:143270165-143270187 CAACCCTGGGTGACAGAGTGAGG - Intergenic
998572093 5:143270381-143270403 GAACTTTGGGAGACAGAGGCGGG - Intergenic
998738140 5:145166907-145166929 GAACAGTGGTTACCAGAGGCTGG + Intergenic
999158150 5:149473186-149473208 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
999231119 5:150062436-150062458 GAATCATGGTTGCCAGGGGCTGG - Intronic
999307801 5:150531743-150531765 GCACCCTGGGAGGCTGAGGCAGG - Intronic
999362972 5:151001666-151001688 GAGCCATGGATGGCAGAGGCCGG + Intergenic
999714335 5:154347606-154347628 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1000104617 5:158047425-158047447 GCACTCTGGGAGCCTGAGGCAGG - Intergenic
1000142158 5:158416115-158416137 GAACAGTGGTTACCAGAGGCGGG + Intergenic
1000531925 5:162433359-162433381 GAACAATGGTTACCAGAGGCTGG - Intergenic
1000555987 5:162726646-162726668 GCACTCTGGGTGGCTGAGGCAGG + Intergenic
1000780350 5:165472763-165472785 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1000972259 5:167727356-167727378 GCACCCTGGGAGGCTGAGGCGGG - Intronic
1001022745 5:168197452-168197474 GCACCTTGGGAGGCAGAGGCAGG + Intronic
1001343766 5:170871291-170871313 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1001503940 5:172261868-172261890 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1001887465 5:175307473-175307495 AAATGCTGGTTGCCAGAGGCTGG + Intergenic
1002084463 5:176763605-176763627 GAATCATGGTTGCCAGGGGCTGG - Intergenic
1002340555 5:178514077-178514099 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1002345517 5:178545470-178545492 GAACAGTGGGTGCCAGGGGCGGG + Intronic
1002377800 5:178800783-178800805 GAACACTGGGAGGCCGAGGCAGG + Intergenic
1003043861 6:2714919-2714941 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1003173106 6:3735583-3735605 GAACAGTGGTTACCAGAGGCTGG + Intronic
1003423389 6:5978182-5978204 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1003465046 6:6371023-6371045 GAATGGTGGGTGCCAGGGGCTGG + Intergenic
1003646181 6:7914639-7914661 GCACTCTGGGAGCCTGAGGCAGG - Intronic
1003813439 6:9811089-9811111 GGACCCTGCGAGCCAGGGGCCGG - Intronic
1003837977 6:10092255-10092277 GCACCTTGGGAGGCAGAGGCAGG - Intronic
1003903781 6:10680004-10680026 GAACTCTGGGAGGCTGAGGCAGG + Intronic
1004081457 6:12398097-12398119 GAATACTGGTTACCAGAGGCTGG + Intergenic
1004214841 6:13692603-13692625 GCACTTTGGGTGGCAGAGGCAGG + Intronic
1004393458 6:15228267-15228289 GCACCCTGGGAGGCCGAGGCAGG + Intergenic
1004492000 6:16126413-16126435 GAGCCCTGGGAGGCCGAGGCAGG - Intergenic
1004704299 6:18109498-18109520 GCACCTTGGGTGACTGAGGCAGG + Intergenic
1005022142 6:21428506-21428528 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1005055792 6:21727850-21727872 GCACTCTGGGAGGCAGAGGCGGG - Intergenic
1005643192 6:27816102-27816124 GCACTCTGGGAGTCAGAGGCGGG + Intergenic
1005775270 6:29124524-29124546 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1005899429 6:30204993-30205015 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1006374150 6:33662686-33662708 GAGTCCGGGGTGCCAGAAGCAGG - Intronic
1006506387 6:34491426-34491448 GAACACTGGGACCCAGAAGCTGG - Intronic
1006597543 6:35204307-35204329 GCACTCTGGGAGCCTGAGGCAGG - Intergenic
1007310144 6:40938901-40938923 GAAAGCTGGTTACCAGAGGCTGG - Intergenic
1007553856 6:42750107-42750129 GAACCTTGGGAGGCAGAGGTGGG - Intronic
1007687581 6:43676095-43676117 GAACTCTGGGAGGCCGAGGCAGG - Intronic
1007831765 6:44644294-44644316 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
1008130264 6:47713168-47713190 GGACTCTGGGTGGCAGAGGTAGG - Intronic
1008641498 6:53467209-53467231 GAAGGCTGGTTACCAGAGGCTGG - Intergenic
1008661903 6:53677356-53677378 AAACAGTGGGTGCCAGGGGCTGG - Intergenic
1009969617 6:70613220-70613242 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1010626769 6:78146285-78146307 GAACAATGGTTACCAGAGGCTGG + Intergenic
1011268247 6:85548720-85548742 GAACTTTGGGTGGCCGAGGCAGG + Intronic
1011273434 6:85603498-85603520 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1011379572 6:86728210-86728232 GAACAGTGGTTACCAGAGGCTGG + Intergenic
1011614783 6:89187638-89187660 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1011704040 6:89983420-89983442 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1012369729 6:98488649-98488671 GAATAGTGGTTGCCAGAGGCAGG - Intergenic
1012555926 6:100511483-100511505 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1012591314 6:100984841-100984863 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1012730391 6:102873825-102873847 GAAACTTGTGTGCCAGAGGATGG + Intergenic
1012865184 6:104610450-104610472 TAACCCCAGTTGCCAGAGGCTGG + Intergenic
1012991872 6:105934438-105934460 GAACCTTGGGAGGCCGAGGCGGG + Intergenic
1013560757 6:111302656-111302678 GTACTCTGGGAGGCAGAGGCAGG + Intronic
1013909745 6:115259944-115259966 GAATCATGGTTACCAGAGGCAGG + Intergenic
1013948753 6:115753738-115753760 GAATGCTGGGTGCCAGAGCCAGG - Intergenic
1014327181 6:120013075-120013097 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1014352409 6:120361372-120361394 GCACTCTGGGAGGCAGAGGCAGG - Intergenic
1014626666 6:123734781-123734803 GCACTCTGGGTGGCCGAGGCGGG + Intergenic
1014693025 6:124585287-124585309 GAACAATGGTTACCAGAGGCTGG + Intronic
1015276750 6:131390230-131390252 GACCCTTGGGAGCCTGAGGCAGG + Intergenic
1015486894 6:133781991-133782013 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
1015857132 6:137636810-137636832 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1016135500 6:140536568-140536590 GAACCATGGTTACCAGAGTCTGG + Intergenic
1016154489 6:140786788-140786810 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1016474488 6:144411477-144411499 GATACCTGGCGGCCAGAGGCAGG - Intronic
1016564918 6:145441615-145441637 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1016837058 6:148488159-148488181 GAACGGTGGCTGCCAGGGGCAGG - Intronic
1017409734 6:154155548-154155570 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1017689060 6:156945179-156945201 GTACTTTGGGTGGCAGAGGCGGG - Intronic
1018041834 6:159931397-159931419 GAATGCTGGTTGCCAGAGGCTGG + Intergenic
1018210988 6:161481356-161481378 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1018763619 6:166911869-166911891 CCAGCCTGGGTGACAGAGGCTGG - Intronic
1018912050 6:168107036-168107058 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1018980796 6:168600157-168600179 GAACCGTGGGAGGCCGAGGCGGG + Intronic
1019037567 6:169074249-169074271 GCACCTTGGGAGGCAGAGGCGGG - Intergenic
1019319110 7:407318-407340 GAATGGTGGGTGCCAGAGGCTGG + Intergenic
1019692233 7:2422489-2422511 GAACCTTGGGAGGCCGAGGCGGG - Intronic
1019777015 7:2917902-2917924 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1020031245 7:4934348-4934370 GCACTCTGGGAGTCAGAGGCGGG - Intronic
1020146303 7:5646445-5646467 GCACCTTGGGAGGCAGAGGCGGG + Intronic
1020153963 7:5706396-5706418 GAACCCTGGGTGCCAGAGGCTGG - Intronic
1020245924 7:6429513-6429535 GAACTCTGGGAGGCTGAGGCAGG + Intronic
1020318769 7:6925348-6925370 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1021222800 7:17992655-17992677 GAACTTTGGGTGGCCGAGGCAGG - Intergenic
1021231988 7:18096255-18096277 GAACACTGGGTAGCACAGGCAGG - Intronic
1021297473 7:18926100-18926122 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1021401544 7:20214991-20215013 GTACCCAGGCTGCCAGAGGAAGG - Intronic
1021436731 7:20626132-20626154 GAACCGCGGTTGCCAGGGGCTGG + Intronic
1021466104 7:20944988-20945010 GAACCTTGGGAGGCCGAGGCGGG - Intergenic
1021504553 7:21367449-21367471 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1021527584 7:21606075-21606097 GCACTTTGGGAGCCAGAGGCAGG + Intronic
1021636323 7:22697707-22697729 GAACTTTGGGAGCCCGAGGCTGG + Intergenic
1021854431 7:24839740-24839762 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1021912130 7:25396811-25396833 GTACACTGTGTCCCAGAGGCAGG + Intergenic
1022318865 7:29269216-29269238 GAATGATGGTTGCCAGAGGCTGG - Intronic
1022334310 7:29407939-29407961 GCACTTTGGGTGGCAGAGGCTGG + Intronic
1022756944 7:33303604-33303626 GAATCATGGGAGCCCGAGGCAGG - Intronic
1022801358 7:33780285-33780307 GCACCCTGTGTGCCACAGGGAGG - Intergenic
1022984996 7:35644519-35644541 GAACTCTGGGAGCCTGAGGCAGG + Intronic
1023069029 7:36409916-36409938 GTACTCTGGGTGGCCGAGGCGGG - Intronic
1023189657 7:37566261-37566283 GAACAATGGTTACCAGAGGCTGG - Intergenic
1023401642 7:39795876-39795898 GCTGCCTGGGTCCCAGAGGCTGG - Intergenic
1023570369 7:41565543-41565565 GAAGCCTGAGAGTCAGAGGCAGG + Intergenic
1023653305 7:42392583-42392605 GCACCTTGGGAGCCCGAGGCAGG - Intergenic
1023909658 7:44544424-44544446 GAACGATGGTTACCAGAGGCTGG + Intergenic
1023985074 7:45089292-45089314 GAACCCTGGTTGTGGGAGGCTGG + Intergenic
1024390179 7:48801029-48801051 GAATTGTGGTTGCCAGAGGCAGG + Intergenic
1024828012 7:53415364-53415386 GCACTCTGGGAGCCTGAGGCGGG + Intergenic
1024910562 7:54443570-54443592 GAATCATGGGAGCCCGAGGCAGG - Intergenic
1025085065 7:56016821-56016843 GAACTTTGGGAGCCTGAGGCGGG - Intronic
1025154738 7:56594500-56594522 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
1025296281 7:57777308-57777330 GTGCCCTGTGTGCCAGAGGGCGG + Intergenic
1025535939 7:61947985-61948007 GAACTTTGGGAGCCTGAGGCTGG - Intergenic
1025608009 7:63053434-63053456 GAACTCTGGGAGGCTGAGGCCGG + Intergenic
1025746212 7:64245270-64245292 GAACCTTGGGAGGCCGAGGCAGG - Intronic
1025796144 7:64739315-64739337 GCACCCTGGGAGGCCGAGGCTGG + Intergenic
1025871982 7:65443145-65443167 GAACAATGATTGCCAGAGGCTGG - Intergenic
1025953740 7:66166651-66166673 GAACTCTGGGAGGCTGAGGCAGG + Intergenic
1025992803 7:66508347-66508369 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1026211957 7:68313650-68313672 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1026265080 7:68789155-68789177 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
1026272453 7:68848440-68848462 GCACCCTGGGAGTCTGAGGCAGG - Intergenic
1026468874 7:70677667-70677689 GAACCTTGGGAGGCCGAGGCAGG - Intronic
1026531488 7:71201877-71201899 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1026782363 7:73277433-73277455 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1027023125 7:74830254-74830276 GCACTTTGGGAGCCAGAGGCAGG + Intronic
1027064804 7:75115042-75115064 GCACTTTGGGAGCCAGAGGCAGG - Intronic
1027193897 7:76014998-76015020 GAACCTTGGGAGGCAGAGGCAGG + Intronic
1027675259 7:81149602-81149624 GAACAATGGTTACCAGAGGCTGG + Intergenic
1028215384 7:88125906-88125928 GAACCCAAGGTGCCACAAGCAGG - Intronic
1028285185 7:88987922-88987944 GAACAATGGTTACCAGAGGCTGG - Intronic
1028571443 7:92291819-92291841 GAACTTTGGGAGCCTGAGGCAGG - Intronic
1028949081 7:96613713-96613735 GAACAGTGGTTACCAGAGGCTGG - Intronic
1028996835 7:97110151-97110173 GCACCCTGGGAGGCTGAGGCGGG + Intergenic
1029040268 7:97565905-97565927 GAACCTTGAGTTCCACAGGCAGG + Intergenic
1029354823 7:100044021-100044043 GCACCCTGGGAGGCTGAGGCAGG - Intergenic
1029438982 7:100577136-100577158 GAGCCCTGGCTTCAAGAGGCTGG + Exonic
1029907725 7:104108318-104108340 GAACTTTGGGGGCCTGAGGCAGG - Intergenic
1030478945 7:110077513-110077535 GAACGATGGTTACCAGAGGCTGG - Intergenic
1030695357 7:112579467-112579489 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1030966763 7:116002506-116002528 GAACAATGGTTGCCTGAGGCTGG + Intronic
1031037218 7:116800669-116800691 GAACTTTGGGAGCCTGAGGCGGG - Intergenic
1031575321 7:123409380-123409402 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1031708480 7:125013349-125013371 GAATGCTGGTTACCAGAGGCTGG + Intergenic
1032032059 7:128492526-128492548 GCACCCTGGGAGGCTGAGGCAGG - Intronic
1032121600 7:129161101-129161123 GAAGCCTGGGTGCCAGAGTGAGG - Intronic
1032338217 7:131045983-131046005 GAACTCTGGGAGGCCGAGGCGGG + Intergenic
1032567496 7:132961796-132961818 GAAAGGTGGTTGCCAGAGGCAGG - Intronic
1032732003 7:134652641-134652663 GAATTATGGTTGCCAGAGGCAGG - Intronic
1033446713 7:141429511-141429533 GAACAGTGGTTACCAGAGGCTGG + Intronic
1033972644 7:147061098-147061120 GAGCGGTGGGTGCCAGGGGCCGG + Intronic
1034046488 7:147934033-147934055 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1034430140 7:151037114-151037136 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1034635928 7:152567115-152567137 GCACCCTGGGAGGCTGAGGCAGG + Intergenic
1034823109 7:154235192-154235214 GATGCCTGGGTGCCAGGGGTTGG - Intronic
1034993689 7:155564972-155564994 GAACCGTGGGTGCCAGGGGCTGG + Intergenic
1035037360 7:155903953-155903975 GAACCCTGGGTTTCTGAGGACGG - Intergenic
1035228639 7:157447496-157447518 GAATGGTGGGTGCCAGGGGCTGG - Intergenic
1035309882 7:157960152-157960174 GAACGGTGGGTACCAGGGGCCGG + Intronic
1035770105 8:2140081-2140103 GAACTGTGGGTACCAGGGGCTGG - Intronic
1036127897 8:6080290-6080312 GAAGAATGGGTACCAGAGGCTGG - Intergenic
1036381647 8:8239845-8239867 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
1036748662 8:11429134-11429156 GAAGGGTGGGTGCCAGGGGCTGG - Intronic
1036835075 8:12056724-12056746 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1036856919 8:12303288-12303310 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1037510156 8:19574386-19574408 GAACCCTATGAGCAAGAGGCTGG - Intronic
1037531503 8:19779200-19779222 CTACCCTGGGTGACAGAGGGAGG + Intergenic
1037769976 8:21792816-21792838 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1037841866 8:22250628-22250650 GAACAATGGTTGCCAAAGGCTGG - Exonic
1037924700 8:22835020-22835042 GACAAGTGGGTGCCAGAGGCTGG + Intronic
1038283441 8:26186137-26186159 GAACGGGGGTTGCCAGAGGCTGG + Intergenic
1038468905 8:27793912-27793934 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1038723698 8:30060483-30060505 GAACTTTGGGAGGCAGAGGCAGG - Intergenic
1038970333 8:32626432-32626454 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1039217611 8:35290449-35290471 GAACAGTGGTTACCAGAGGCTGG + Intronic
1039237086 8:35513473-35513495 GCACCTTGGGAGGCAGAGGCAGG - Intronic
1039470652 8:37811720-37811742 GAACTCTGGGAGGCTGAGGCGGG - Intronic
1039660893 8:39463612-39463634 GAATCATGGTTGCCAGAGCCTGG + Intergenic
1039739077 8:40363378-40363400 GAACTCTGGGTGGCCGAGGTGGG - Intergenic
1039874036 8:41570318-41570340 GCACCTTGGGAGGCAGAGGCAGG + Intergenic
1040371004 8:46774289-46774311 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1040497628 8:47980848-47980870 GCAGCCTGGGTGACAGAGACAGG - Intergenic
1040840641 8:51780904-51780926 GCACCCTGGGAGGCCGAGGCAGG - Intronic
1041085006 8:54248643-54248665 GAATCCTGGTTACCAGGGGCTGG + Intergenic
1041449509 8:57992544-57992566 GAACTTTGGGCGCCTGAGGCAGG + Intergenic
1041540187 8:58975825-58975847 GCACTCTGGGTGGCCGAGGCGGG + Intronic
1041568863 8:59313157-59313179 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
1041775108 8:61514810-61514832 GAACTTTGGGTGCCCAAGGCAGG - Intronic
1041797447 8:61760388-61760410 GAGCCCTGGTTGCCAAAGCCAGG - Intergenic
1041929573 8:63272153-63272175 GCACCTTGGGTGGCCGAGGCAGG - Intergenic
1042261165 8:66860874-66860896 GCACCCTGGGAGGCCGAGGCAGG + Exonic
1042891031 8:73610288-73610310 CAACTCTGGGTGGCAAAGGCAGG + Intronic
1042910039 8:73817077-73817099 GAACTCTGGGAGGCTGAGGCGGG + Intronic
1042913298 8:73848438-73848460 GAACTCTGGGTGGCTGAGGTGGG + Intronic
1042982749 8:74548923-74548945 AAACCCTGGGGGACTGAGGCTGG - Intergenic
1043161981 8:76856755-76856777 GAACTCTGGGTGTCACAGGGTGG - Intronic
1043420233 8:80090143-80090165 GAACTCTGGGAGGCTGAGGCAGG + Intronic
1043458996 8:80440569-80440591 GAACAGTGGTTGCCAGAGACTGG + Intergenic
1043509464 8:80935123-80935145 GAATCGTGGCTACCAGAGGCTGG - Intergenic
1043699134 8:83262089-83262111 GCACTTTGGGTGGCAGAGGCGGG + Intergenic
1044172763 8:89076093-89076115 GAATGGTGGGTACCAGAGGCTGG + Intergenic
1044561487 8:93616996-93617018 GAACAGTGGTTGCCAGGGGCTGG + Intergenic
1044648210 8:94467172-94467194 GCACCTTGGGAGGCAGAGGCGGG - Intronic
1044679619 8:94763918-94763940 GCACGCTGGGAGGCAGAGGCGGG - Intronic
1044849518 8:96414854-96414876 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1044850847 8:96425877-96425899 GAATGATGGTTGCCAGAGGCTGG - Intergenic
1045041045 8:98225001-98225023 GAACTTTGAGTGGCAGAGGCGGG - Intronic
1045343510 8:101274457-101274479 GGACCCTGAGTGCCCGAAGCTGG + Intergenic
1045439333 8:102194038-102194060 GAACTTTGGGTGGCTGAGGCAGG + Intergenic
1045482069 8:102600722-102600744 GAAGCCTGGGTGTCTGTGGCAGG - Intergenic
1045776976 8:105816011-105816033 GAACGATGGTTGCCAGAGGCTGG - Intergenic
1045812552 8:106239991-106240013 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1046053427 8:109051061-109051083 AATCCCTGGTTGCCAGAGGCTGG + Intergenic
1046392554 8:113594646-113594668 GAACTTTGGGTGGCTGAGGCGGG - Intergenic
1046560219 8:115827090-115827112 GCACCCTGGGTGGCTGAGGCTGG - Intergenic
1046929520 8:119828197-119828219 GAACCCAGGGTCACAGAGACAGG - Intronic
1047396100 8:124500458-124500480 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1048079727 8:131112301-131112323 GAAGGATGGTTGCCAGAGGCTGG - Intergenic
1048125314 8:131628682-131628704 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1048346799 8:133581894-133581916 GAACTCTGTGAGCCAGAGTCTGG + Intergenic
1048349379 8:133603791-133603813 GCACCCTGGGGGTCACAGGCTGG + Intergenic
1048492201 8:134904100-134904122 GAACTCTGGGAGGCAGAGGTAGG + Intergenic
1049084602 8:140468908-140468930 GAACTTTGGGAGGCAGAGGCAGG + Intergenic
1049156156 8:141067914-141067936 GAACTCTGTGTGCCCTAGGCTGG + Intergenic
1049193371 8:141301494-141301516 GCACTCTGGGAGCCTGAGGCAGG + Intronic
1049224561 8:141443737-141443759 GAATGCTGGGTGCCAGGGGCTGG - Intergenic
1049243426 8:141550006-141550028 GAAGGCTGGGTGCCTGGGGCAGG - Intergenic
1049321351 8:141998607-141998629 GAGCCATGGGGGCCAGAAGCAGG - Intergenic
1049667428 8:143852488-143852510 GAGGCCTGGGTGCAGGAGGCTGG - Intergenic
1049672953 8:143877863-143877885 GACCCGTGGGAGGCAGAGGCAGG - Intronic
1049826564 8:144672542-144672564 GCACCCTGGCTGCCAGGAGCTGG + Intergenic
1049996049 9:1035053-1035075 GCACTCTGGGTGCCCAAGGCAGG - Intergenic
1050044713 9:1530831-1530853 GAACCGTGGTTACCAGGGGCGGG + Intergenic
1050571236 9:6941253-6941275 GAACTCTGGGAGGCTGAGGCCGG - Intronic
1050837691 9:10104139-10104161 GAATGGTGGGTGCCAGGGGCTGG + Intronic
1050900192 9:10938448-10938470 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1051056458 9:12993086-12993108 CAAGCCTGGGTGCCAGAGCGAGG - Intergenic
1051242667 9:15076403-15076425 GAATGCTGGTTGCCAGGGGCTGG + Intergenic
1051272297 9:15367258-15367280 GATCAGTGGTTGCCAGAGGCTGG - Intergenic
1051981042 9:23017329-23017351 GAACGCTGGTTATCAGAGGCTGG + Intergenic
1052672586 9:31577169-31577191 GAACTCTGGGAGTCCGAGGCAGG + Intergenic
1052855873 9:33406064-33406086 GCACTCTGGGAGCCCGAGGCGGG - Intergenic
1052947085 9:34177228-34177250 GAACTCTGGGAGGCTGAGGCAGG - Intergenic
1053119272 9:35533638-35533660 GATCAGTGGCTGCCAGAGGCTGG - Intronic
1053241220 9:36497131-36497153 GCACCTTGGGAGGCAGAGGCGGG + Intergenic
1053318072 9:37069445-37069467 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1053506449 9:38647671-38647693 GATCCTTGGGAGGCAGAGGCAGG - Intergenic
1053585374 9:39452425-39452447 GAACCTTGGGAGGCCGAGGCAGG - Intergenic
1053619905 9:39804224-39804246 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1054264252 9:62903220-62903242 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1054580940 9:66912799-66912821 GAACCTTGGGAGGCCGAGGCAGG + Intronic
1054743114 9:68828305-68828327 GAGGCCTCGGTGCCACAGGCAGG - Intronic
1055013544 9:71592308-71592330 GAAACCTGGGAGGCAGAGGGAGG + Intergenic
1055085176 9:72306397-72306419 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1055214716 9:73845239-73845261 GCACTCTGGGAGACAGAGGCAGG + Intergenic
1055304738 9:74917777-74917799 GCACTCTGGGAGGCAGAGGCAGG + Intergenic
1055453065 9:76448203-76448225 GCACTCTGGGAGCCCGAGGCAGG + Intronic
1055532314 9:77196498-77196520 GAATAGTGGTTGCCAGAGGCTGG - Intronic
1055605877 9:77969970-77969992 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1055828257 9:80352640-80352662 GCACTTTGGGTGGCAGAGGCGGG + Intergenic
1056171543 9:83990149-83990171 GAACAATGGTTACCAGAGGCTGG + Intronic
1056419295 9:86408151-86408173 GCACCTTGGGAGGCAGAGGCAGG - Intergenic
1056663868 9:88565030-88565052 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1056803420 9:89709890-89709912 GAAACATGAATGCCAGAGGCTGG + Intergenic
1057134573 9:92678566-92678588 GAATGATGGCTGCCAGAGGCTGG + Intergenic
1057365653 9:94418105-94418127 GCACTCTGGGAGCCCGAGGCGGG - Intronic
1057448323 9:95134743-95134765 GAGCCCAGGGTGCCAGACACTGG + Intronic
1057532082 9:95857872-95857894 GAGCCCTGGGTGCCAGGGCTGGG - Intergenic
1057762820 9:97890370-97890392 CCACCCTGTGTACCAGAGGCTGG + Intergenic
1058042799 9:100322860-100322882 GAACTCTGGGAGACCGAGGCAGG - Intronic
1058340484 9:103889651-103889673 GAATGCTGGTTACCAGAGGCTGG - Intergenic
1058406472 9:104681196-104681218 GAACGATGGTTACCAGAGGCTGG + Intergenic
1058448492 9:105074624-105074646 GAAGGGTGGTTGCCAGAGGCTGG + Intergenic
1058681177 9:107441567-107441589 GAACAGTGGCTGCCAGGGGCTGG + Intergenic
1058731970 9:107859127-107859149 GCACCCTGGGGGCCAAAGTCAGG - Intergenic
1058733164 9:107869508-107869530 GCACTCTGGGAGCCCGAGGCGGG + Intergenic
1058923229 9:109638289-109638311 GACCAGTGGTTGCCAGAGGCTGG + Intergenic
1058985352 9:110204778-110204800 GAATGGTGGTTGCCAGAGGCTGG - Intronic
1059115705 9:111598964-111598986 GAATGATGGTTGCCAGAGGCTGG - Intronic
1059141534 9:111857581-111857603 GATCCCAGGGAGCAAGAGGCAGG - Intergenic
1059195203 9:112364960-112364982 GAAGGGTGGCTGCCAGAGGCTGG - Intergenic
1059430822 9:114249366-114249388 GAACCCAGGGAACCAGGGGCAGG + Intronic
1059931708 9:119267386-119267408 GAACTCTGGGAGCCTGAGGTGGG + Intronic
1060063060 9:120478354-120478376 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1060098567 9:120816192-120816214 GAATGGTGGTTGCCAGAGGCTGG + Exonic
1060100418 9:120835759-120835781 GATTCCTGGTTGCCAGAGGCTGG + Intronic
1060197223 9:121631569-121631591 GAACTCTGGGAGGCCGAGGCTGG + Intronic
1060222702 9:121773015-121773037 GAACCCTGTGTACCAGATGGCGG + Exonic
1060252166 9:121995209-121995231 GGCACCTGGGAGCCAGAGGCTGG + Intronic
1060294490 9:122333923-122333945 GCACTTTGGGAGCCAGAGGCGGG + Intergenic
1060389639 9:123267744-123267766 GAGCGCTGCGTGCCAGGGGCAGG - Intronic
1060436541 9:123597915-123597937 TCAGCCTGGCTGCCAGAGGCAGG + Intronic
1060613013 9:124985619-124985641 GAACTTTGGGAGGCAGAGGCGGG + Intronic
1060668418 9:125447483-125447505 GAACCCTGGGGGGCAAGGGCAGG + Intronic
1061075563 9:128339610-128339632 GATCCCTGGGAGGCTGAGGCAGG - Intergenic
1061294572 9:129670005-129670027 GACTGCTGGGTGCCAGGGGCTGG - Intronic
1061334746 9:129925258-129925280 GCACTCTGGGAGGCAGAGGCGGG + Intronic
1061436513 9:130566313-130566335 GCACCCTGGGAGCCTGAGGTGGG - Intergenic
1061503344 9:131016225-131016247 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1061713304 9:132502495-132502517 GAATGGTGGGTGCCAGGGGCTGG - Intronic
1061856549 9:133444811-133444833 TTCCCCTGGGTGGCAGAGGCAGG + Intronic
1061899583 9:133666125-133666147 GACCCCTGGCTGCAGGAGGCAGG - Intronic
1061938765 9:133872864-133872886 GCACTCTGGGAGGCAGAGGCAGG + Intronic
1062052555 9:134455149-134455171 GACCCCTGGGTGCTGGAGTCTGG + Intergenic
1062317047 9:135972546-135972568 GAAAGGTGGGTGCCAGGGGCTGG - Intergenic
1062348840 9:136128863-136128885 GAAAGGTGGGTGCCAGGGGCTGG + Intergenic
1062428171 9:136515601-136515623 GTAGCCTGGGCGGCAGAGGCAGG + Exonic
1062518248 9:136946633-136946655 GAAGCCTGGGGGCCCAAGGCAGG - Exonic
1062571724 9:137188890-137188912 GAGCCCTCCGTGCCGGAGGCCGG + Intronic
1203448745 Un_GL000219v1:89315-89337 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1185433643 X:24472-24494 GAATGGTGGGTGCCAGGGGCCGG + Intergenic
1185442848 X:236540-236562 GAATGGTGGGTGCCAGGGGCCGG + Intergenic
1185478591 X:429661-429683 GGACCCTGGATGGCCGAGGCAGG - Intergenic
1185516794 X:705941-705963 GAATGGTGGGTACCAGAGGCTGG - Intergenic
1185555874 X:1020664-1020686 GAACTGTGGGTGGCAGGGGCTGG - Intergenic
1185591042 X:1277349-1277371 GCACCTTGGGAGGCAGAGGCGGG + Intronic
1185765740 X:2724520-2724542 GAACTCTGGGAGGCTGAGGCGGG + Intronic
1185828691 X:3277411-3277433 GAATGGTGGGTGCCAGAGGATGG + Intronic
1185868970 X:3647892-3647914 GAATGGTGGGTGCCAGGGGCCGG - Intronic
1185891447 X:3825601-3825623 GAGCCCGGGGTGTAAGAGGCCGG + Intronic
1185896553 X:3864015-3864037 GAGCCCGGGGTGTAAGAGGCCGG + Intergenic
1185901671 X:3902441-3902463 GAGCCCGGGGTGTAAGAGGCCGG + Intergenic
1186413735 X:9365398-9365420 GAACGATGGTTGCCAGGGGCTGG - Intergenic
1186530571 X:10291011-10291033 GATCCGTGGCTGCCAGGGGCTGG - Intergenic
1186917299 X:14237288-14237310 GAATGGTGGTTGCCAGAGGCTGG + Intergenic
1187961382 X:24569725-24569747 GAAGGCTGGCTGCCAGGGGCTGG + Intronic
1187963907 X:24592063-24592085 GAACAGTGGTTACCAGAGGCTGG - Intronic
1188094675 X:26006529-26006551 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1188214190 X:27458086-27458108 GCACCTTGGGTGGCCGAGGCGGG - Intergenic
1188227632 X:27621139-27621161 GAATGGTGGTTGCCAGAGGCTGG + Intronic
1188445182 X:30247696-30247718 GAACTCTGGGAGGCCGAGGCAGG + Intronic
1188454422 X:30346523-30346545 GAACAATGGTTACCAGAGGCTGG + Intergenic
1188474767 X:30579561-30579583 GAAGCATGGTTACCAGAGGCTGG - Intergenic
1188991170 X:36822489-36822511 GAACTTTGGGAGACAGAGGCAGG - Intergenic
1189057235 X:37710977-37710999 GATGCCTGGGTTCCAGAGCCTGG + Intronic
1189087431 X:38040488-38040510 GAAGGATGGTTGCCAGAGGCTGG - Intronic
1189107116 X:38248506-38248528 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1189163041 X:38830772-38830794 GAACAGTGGTTACCAGAGGCTGG + Intergenic
1190480150 X:50869224-50869246 GAAGCATGGTTACCAGAGGCTGG - Intergenic
1190573512 X:51809358-51809380 GCACTCTGGGAGGCAGAGGCGGG - Intronic
1190576316 X:51842939-51842961 GAACTCTGGGAGGCTGAGGCGGG - Intronic
1190806851 X:53845993-53846015 GAACAATGGTTACCAGAGGCTGG - Intergenic
1190896386 X:54622529-54622551 GCACCCTGGGAGGCCGAGGCAGG - Intergenic
1191883830 X:65869018-65869040 GAATAGTGGTTGCCAGAGGCTGG + Intergenic
1192017484 X:67347116-67347138 GGGCCCTGGGTGCCAGAAGATGG + Intergenic
1192029871 X:67498441-67498463 GAAGGATGGTTGCCAGAGGCTGG + Intergenic
1192372389 X:70525337-70525359 GCACACTGGGAGGCAGAGGCGGG + Intergenic
1192381057 X:70616855-70616877 GAACGATGGTTACCAGAGGCTGG + Intronic
1192617081 X:72637229-72637251 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1192637728 X:72835629-72835651 GAATGATGGTTGCCAGAGGCTGG + Intronic
1192643986 X:72885186-72885208 GAATGATGGTTGCCAGAGGCTGG - Intronic
1192769487 X:74172403-74172425 GAACTTTGGGAGCCTGAGGCAGG - Intergenic
1192774361 X:74226716-74226738 GCACCTTGGGAGGCAGAGGCCGG + Intergenic
1192845294 X:74900974-74900996 GAATGCTGGCTGCCAGGGGCTGG + Intronic
1193055730 X:77147735-77147757 GAATGCTGGTTGCTAGAGGCTGG + Intergenic
1193123969 X:77851761-77851783 GCACTCTGGGAGGCAGAGGCAGG - Intronic
1194036010 X:88873190-88873212 GAATGGTGGGTGCCAGAGACTGG + Intergenic
1194066062 X:89263836-89263858 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1194258975 X:91670674-91670696 GCACTCTGGGAGGCAGAGGCGGG + Intergenic
1194568938 X:95529193-95529215 GAAGCATGGTTACCAGAGGCTGG + Intergenic
1194709501 X:97217699-97217721 GAACTTTGGGAGGCAGAGGCAGG + Intronic
1194815571 X:98437237-98437259 GAACGATGGTTACCAGAGGCTGG - Intergenic
1195053533 X:101121120-101121142 GAACCTTGGGAGGCCGAGGCGGG - Intronic
1195362642 X:104099089-104099111 GAACTGTGGTTACCAGAGGCTGG + Intergenic
1195899863 X:109786488-109786510 GCACCTTGGGTGGCTGAGGCAGG - Intergenic
1195995933 X:110731783-110731805 GAACACTGGATGCCAGGAGCTGG + Intronic
1196322439 X:114357308-114357330 GAAGCATGGTTACCAGAGGCTGG + Intergenic
1196517977 X:116635965-116635987 GAAGGATGGGTACCAGAGGCTGG + Intergenic
1196753782 X:119140280-119140302 GCACCCTGGGAGGCCGAGGCAGG + Intronic
1196847163 X:119905409-119905431 GAACCCTGAGTGCAGTAGGCAGG - Intronic
1196961761 X:121011073-121011095 GAACAATGGTTACCAGAGGCTGG - Intergenic
1196993709 X:121357236-121357258 GAATGCTGGTTGCCAGAGGCTGG - Intergenic
1197789326 X:130235861-130235883 GAACAATAGTTGCCAGAGGCTGG - Intronic
1198259937 X:134956718-134956740 GTACTCTGGGAGGCAGAGGCAGG + Intergenic
1198446725 X:136724734-136724756 GAACTTTGGGAGGCAGAGGCAGG - Intronic
1198493189 X:137164224-137164246 GAACTCTGGGAGGCCGAGGCAGG - Intergenic
1198504143 X:137284478-137284500 GAATCATGGTTACCAGAGGCTGG + Intergenic
1198646676 X:138815163-138815185 GAATGCTGGTTGCCAGGGGCTGG + Intronic
1198744215 X:139873250-139873272 GAACAGTGGTTGCCAGGGGCTGG + Intronic
1198794057 X:140377186-140377208 GAACTTTGGGAGGCAGAGGCGGG + Intergenic
1198853038 X:140986191-140986213 GAACTTTGGGAGGCAGAGGCGGG - Intergenic
1199050909 X:143235841-143235863 GAAGACTGGTTGCCAGAGGTTGG + Intergenic
1199195424 X:145023825-145023847 GAAGGCTGGCTACCAGAGGCTGG + Intergenic
1199334537 X:146602765-146602787 GAATCCTGGTTGCCAGGGTCTGG - Intergenic
1199377062 X:147125327-147125349 GCACTTTGGGAGCCAGAGGCAGG + Intergenic
1200082245 X:153583469-153583491 GAAGATTGGGTGCCAGGGGCTGG - Intergenic
1200101101 X:153689325-153689347 GAACACTGGGTGCCCGAGCCAGG + Intronic
1200179528 X:154141780-154141802 GAAGGGTGGGTGCCAGGGGCTGG - Intergenic
1200180610 X:154148217-154148239 CCAGCCTGGGTGCCAGAGCCAGG + Intronic
1200213586 X:154357619-154357641 GGATCCTGTGTGGCAGAGGCAGG + Exonic
1200272966 X:154704225-154704247 GAAGAATGGTTGCCAGAGGCTGG + Intronic
1200334869 X:155339844-155339866 GAACAGTGGTTACCAGAGGCAGG - Intergenic
1200351597 X:155501377-155501399 GAACAGTGGTTACCAGAGGCAGG + Intronic
1200606853 Y:5274589-5274611 GCACCTTGGGAGCCCGAGGCAGG - Intronic
1200720230 Y:6597956-6597978 GAATGGTGGTTGCCAGAGGCTGG - Intergenic
1200800632 Y:7384086-7384108 GAACGTTGGGAGCCTGAGGCAGG + Intergenic
1201700942 Y:16881382-16881404 GTACCCTGGGAGGCTGAGGCAGG + Intergenic
1202074952 Y:21028172-21028194 GGACCCTGGGTGCAAGGGTCAGG + Intergenic