ID: 1020156404

View in Genome Browser
Species Human (GRCh38)
Location 7:5728200-5728222
Sequence TCTCCAGAAGGGCCACCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020156404_1020156408 -5 Left 1020156404 7:5728200-5728222 CCTCAGGGTGGCCCTTCTGGAGA 0: 1
1: 0
2: 1
3: 26
4: 283
Right 1020156408 7:5728218-5728240 GGAGACCCTTGGTCTACCTTAGG 0: 2
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020156404 Original CRISPR TCTCCAGAAGGGCCACCCTG AGG (reversed) Intronic
900310359 1:2030457-2030479 TCACCCGAAAGGCCAGCCTGGGG + Exonic
900980152 1:6041628-6041650 TCTGCAGCAGCGCCACCCGGTGG - Intronic
904056033 1:27670680-27670702 TCTCCAGAAGCACCACCCACTGG + Intronic
907056271 1:51371274-51371296 TCTCCTGAAGGACCTGCCTGAGG - Intronic
911327515 1:96485916-96485938 TCTCCTGAAGGACCTACCTGAGG - Intergenic
912932961 1:113980863-113980885 TCTCCAGATCACCCACCCTGGGG + Intronic
914944139 1:152048576-152048598 TCACCAGAACTGCCACCCTCGGG - Intergenic
915052588 1:153091499-153091521 TCCCCATAACTGCCACCCTGTGG - Intergenic
916865579 1:168853887-168853909 TCTCAATAAGGCCCACCCTCAGG + Intergenic
917547865 1:175991905-175991927 TCTCCTGAAGGGCCTGCCTGAGG + Intronic
918278417 1:182978133-182978155 CCTCCTGAAGGACCAGCCTGAGG + Intergenic
920079614 1:203362792-203362814 ACTGCAGAGGGGCCTCCCTGTGG + Intergenic
920680237 1:208066689-208066711 CCTCCTGAAGGTCCTCCCTGAGG - Intronic
920918086 1:210274477-210274499 TCTCCTGAAGGACCTCCCTAAGG + Intergenic
921141548 1:212311625-212311647 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
922084531 1:222333342-222333364 TCTCCACAATGTACACCCTGTGG + Intergenic
1062979579 10:1710791-1710813 TGGCCAGAAAGACCACCCTGGGG + Intronic
1065105259 10:22377260-22377282 TCGCCTGAAGGCCCACCTTGGGG - Intronic
1065631106 10:27681954-27681976 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
1067082842 10:43221400-43221422 GCAGCAGGAGGGCCACCCTGGGG - Intronic
1067091512 10:43267935-43267957 TCTCTTGAACGGACACCCTGTGG + Intergenic
1067249262 10:44573625-44573647 TCTGCAGAAGTGACACCTTGTGG - Intergenic
1067427299 10:46219931-46219953 TCTGCAGAAGCTCTACCCTGGGG - Intergenic
1067582732 10:47455816-47455838 TCTGCAGAAGCTCTACCCTGGGG - Intergenic
1067826213 10:49575244-49575266 CCTCCAGAAGGCCCTGCCTGAGG + Intergenic
1069725628 10:70576095-70576117 TCTCCAGAAGCTGCACCCAGAGG - Intergenic
1069779349 10:70944987-70945009 TCTGCACAAGGACCACCATGGGG + Intergenic
1069956283 10:72053895-72053917 TGTCCTGGAGGGCCAGCCTGGGG - Intergenic
1072818246 10:98530821-98530843 TCTCCAGTAGGGCCACCTCGGGG - Intronic
1073466621 10:103698044-103698066 GCTCCAAAGGGGCCACGCTGAGG + Intronic
1075010578 10:118866265-118866287 TCTGCACAAAGGCCTCCCTGGGG - Intergenic
1075777830 10:124999494-124999516 TCCCCACAAGGGCCACCCCTAGG + Intronic
1076510758 10:131012259-131012281 TCTCCAGTTGGACCACCCTCTGG - Intergenic
1076511071 10:131013792-131013814 ACTCCACAATGGCCACTCTGTGG - Intergenic
1076548085 10:131259644-131259666 ACACCAGAATGGCCACCCTCCGG + Intronic
1076586473 10:131551835-131551857 ACTGCAGAAAGGCCAGCCTGTGG + Intergenic
1076677026 10:132152419-132152441 TACCCAGAAGGGCCACCCAGGGG + Intronic
1076869488 10:133186368-133186390 TGTCCAGAAAGGCCTTCCTGGGG - Exonic
1078544454 11:12236687-12236709 TCTCCACAAGTGCCACCTTCTGG + Intronic
1079013967 11:16853482-16853504 TGTCCAGAAGGGCTTCCCGGAGG - Intronic
1079061748 11:17254964-17254986 TCTCCTGAAGGGCGTGCCTGAGG + Intronic
1080696053 11:34603836-34603858 TCTCCAGGAGGGACACCACGAGG - Intergenic
1080797160 11:35575343-35575365 TCTCCAGAAGAGTCAACTTGAGG - Intergenic
1081400395 11:42636173-42636195 GCTCCAGTAGGGACACCGTGTGG - Intergenic
1081508783 11:43746562-43746584 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1081749650 11:45500795-45500817 TTTCCAGGAGTGCCAACCTGTGG - Intergenic
1083311173 11:61784499-61784521 TCTCCACAAGGGACACTCTGGGG + Intronic
1083342591 11:61967999-61968021 TTTCCCGAACGGGCACCCTGAGG + Intergenic
1083807258 11:65082146-65082168 TTTTGAGAAGGGCTACCCTGGGG - Intronic
1084268854 11:68018687-68018709 CACCCAGAGGGGCCACCCTGTGG - Intronic
1084464386 11:69313622-69313644 TCTTCATATGGGCCACACTGAGG + Intronic
1085015181 11:73169366-73169388 TGACCAGGAAGGCCACCCTGTGG + Intergenic
1087819703 11:102698020-102698042 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
1089159304 11:116425151-116425173 TCCCAAGGAGGGCCAGCCTGAGG + Intergenic
1089262204 11:117231160-117231182 TCTCCACTGGGTCCACCCTGGGG + Intronic
1091221133 11:133930757-133930779 TCCCCAGAAAGACCTCCCTGAGG + Intronic
1091745035 12:2986273-2986295 CCTCCCGAAGGGCCTGCCTGAGG + Intronic
1093385467 12:18548124-18548146 TCTCCTGAAGGGATACCCTCAGG - Intronic
1093860152 12:24155562-24155584 TCTGCAGGAAGGCCACCATGTGG - Intergenic
1096685136 12:53283325-53283347 TCTCCAGAGGATCCACACTGTGG + Intronic
1097630871 12:62060611-62060633 CCTCCTGAAGGACCTCCCTGAGG - Intronic
1098045682 12:66398073-66398095 TCTTGAGAAGGGCCCCACTGTGG + Intronic
1100857236 12:98768394-98768416 TCTGCAGAAGGCCACCCCTGTGG + Intronic
1101164705 12:102016567-102016589 TCTCCTGAAGGACCTCCCTGAGG - Intronic
1101850782 12:108400368-108400390 TCTCCTAAATGGACACCCTGGGG - Intergenic
1102812707 12:115838116-115838138 TGTCCACCAGGGCCACGCTGTGG - Intergenic
1106542449 13:30702184-30702206 TCTCCAGAACGGCCACCTGGTGG + Intergenic
1106707736 13:32299850-32299872 TCTCCAGAGGGGTCAACCTGAGG - Intergenic
1107334901 13:39344446-39344468 TCTGCAAAAGGGCCACTTTGAGG + Intronic
1108423655 13:50276351-50276373 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1108979687 13:56494822-56494844 TCTCCTGAAGGGCCTGCCTGAGG + Intergenic
1111924111 13:94444709-94444731 TCTCCATATGAGACACCCTGGGG - Intronic
1112449344 13:99494781-99494803 CCTCCAAAATGGCCACTCTGGGG - Intergenic
1112486905 13:99828029-99828051 TCCCCAGAAGGGCACCCCTCAGG - Intronic
1113460709 13:110480034-110480056 TCTCCAGAAAGGCCAGCCCCAGG + Intronic
1113892775 13:113744875-113744897 TCTCCAGCAGGGCAGCCGTGTGG + Intergenic
1117741981 14:58828122-58828144 TCTCCAGAATGGCCTCAATGTGG + Intergenic
1120523381 14:85549871-85549893 TCTCCTAAAGGGCCTCCCTGTGG + Intronic
1120634234 14:86931513-86931535 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
1121317938 14:92973397-92973419 TCTCCCGCCTGGCCACCCTGTGG + Intronic
1122325183 14:100877524-100877546 TCTCCTGAAGGCCACCCCTGGGG - Intergenic
1122370253 14:101225581-101225603 TCCCCACAAGGGCCCCCCGGGGG + Intergenic
1122429150 14:101628990-101629012 ACTCCATGATGGCCACCCTGGGG - Intergenic
1122589911 14:102841268-102841290 TCTGCAGAAGGGCCCCCTTGAGG + Intronic
1122636649 14:103132776-103132798 TCTCCACAGGGGCCGCCCAGCGG - Exonic
1122871835 14:104642297-104642319 TCTCCACAAGGCCCACCCTGTGG - Intergenic
1123030100 14:105447546-105447568 TTTCCAGAAGGGCCTCGTTGGGG + Intronic
1125729078 15:41882722-41882744 GCTCCAGCAGGGCCCGCCTGAGG + Exonic
1126236036 15:46385452-46385474 TCTCCAGAATGGCACCACTGTGG - Intergenic
1129152388 15:73697123-73697145 GCCCCACAAGGGCCACCCTGAGG - Intronic
1132358648 15:101193330-101193352 TCTCCAGCAGGGAAAACCTGAGG + Intronic
1132880030 16:2158109-2158131 TCTCCTGGATGGACACCCTGCGG + Intronic
1132982120 16:2743497-2743519 TCTCCAGATGCCCCACCCTCTGG - Intergenic
1133148251 16:3806828-3806850 AGTCCAGAAAGGCCACCATGAGG - Intronic
1133239074 16:4403980-4404002 TCCCCAGAAGGGGCTCCCTGGGG + Intronic
1134111144 16:11516168-11516190 CCTCCTGCAGGGCCACCCAGGGG - Exonic
1134157919 16:11859065-11859087 TCTCCTGAAGGACCTCTCTGAGG - Intergenic
1136425160 16:30165272-30165294 ACTCCAGGAGGCCCTCCCTGGGG + Intergenic
1137565508 16:49530295-49530317 TCTCGAGTAAGGCCTCCCTGAGG - Intronic
1140057245 16:71536295-71536317 TCTTCAGACAGGCCACCCAGGGG - Intronic
1141161603 16:81632829-81632851 TCTACATAAGGGCCAGCCTTGGG + Intronic
1141187009 16:81795299-81795321 TCTACAGAGAGGCCACCCTGAGG - Intronic
1141504121 16:84463420-84463442 GTTCCAGAAGGGCCTGCCTGTGG - Intronic
1141843039 16:86586663-86586685 TCTCCATAAGGGCCACTCAGTGG + Intergenic
1141863755 16:86735791-86735813 TCTCCAGAAGGGGCAGCATCTGG + Intergenic
1142273770 16:89105059-89105081 CCTCCTGAAGAGCCTCCCTGAGG + Intronic
1143145722 17:4773917-4773939 TCTCAAGAAGCACCACCCGGTGG + Intronic
1143262490 17:5610132-5610154 TCTCCAGAAGGTACACCTTGTGG - Intronic
1143789443 17:9281976-9281998 TCTCCACCAGGGCCCTCCTGGGG + Intronic
1143918028 17:10309192-10309214 TCCGCTGAAGGTCCACCCTGGGG - Intronic
1146445971 17:32933258-32933280 TCTCCAGAATGGCCTCAATGTGG - Exonic
1146570050 17:33944678-33944700 TCTCTGGCAGGGCAACCCTGAGG - Intronic
1147763662 17:42818249-42818271 TCTCGAGAAGGTCCAGGCTGAGG - Exonic
1149734748 17:58982431-58982453 ACTCCAGAGGGGCCACCCATAGG - Exonic
1151183460 17:72346544-72346566 CCTCCAGAAGGGACACCATGAGG - Intergenic
1151534485 17:74730970-74730992 GCTCTAGGAGGCCCACCCTGAGG - Intronic
1152085161 17:78213581-78213603 TTTCCAGGAGGGCCACCTTCTGG - Intergenic
1152771759 17:82174110-82174132 TCTCCTGTGGAGCCACCCTGAGG + Intronic
1154228168 18:12527604-12527626 TCTCCAGAAGTGGGAACCTGAGG - Intronic
1155874922 18:31074263-31074285 TCTCCAGAAAGCAGACCCTGAGG - Intronic
1156883892 18:42112122-42112144 TCTCTAAAATGGCCACTCTGGGG + Intergenic
1157532081 18:48429679-48429701 TCTTCAGAAAGGCCAGGCTGGGG + Intergenic
1159870261 18:73753423-73753445 CCTCCTGAAGGACCAGCCTGAGG - Intergenic
1160951916 19:1671919-1671941 TCACCAGGAGGGCTTCCCTGGGG - Intergenic
1161541782 19:4856203-4856225 GTTACAGAAGGGCCACCCTCGGG - Intronic
1162845510 19:13389313-13389335 TCTCCAGGAGGGACACCAGGTGG + Intronic
1163284664 19:16338832-16338854 TCCCCAGAAAGGCCAACCTGGGG - Intergenic
1163346319 19:16744725-16744747 TCTCCAGAGGGGAGTCCCTGCGG - Intronic
1165434587 19:35789058-35789080 CCTCCAGCAGGTCCATCCTGGGG + Intergenic
1165699166 19:37924380-37924402 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1166275669 19:41752140-41752162 TCTCCCCAAGGGCCACTTTGAGG + Intronic
1166719264 19:44988073-44988095 TCTCCAGCAGGGCCACCTGCAGG - Exonic
1167320915 19:48796749-48796771 TCTGCAGCAGGGCAACCCTCTGG - Intronic
1168399176 19:56074154-56074176 CCTCCAGAAGGACCTGCCTGAGG + Intergenic
925677873 2:6385290-6385312 TCTCCTGAAGGACCTGCCTGGGG + Intergenic
927319662 2:21728300-21728322 CCTCTAGAATGGCCTCCCTGTGG - Intergenic
928070292 2:28208492-28208514 CCTCCAGAAGGGGTGCCCTGAGG + Intronic
928399034 2:30964819-30964841 CCTGCAGTAGGGTCACCCTGAGG - Intronic
928437542 2:31265143-31265165 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
930703033 2:54478366-54478388 TCCCCTGATGGGCCACCCTCTGG + Intronic
931249486 2:60517319-60517341 ACCCCAGAAGGGCCACACTTTGG + Intronic
933721204 2:85398740-85398762 TCTGAAGGAGGGCAACCCTGAGG - Exonic
935862698 2:107350205-107350227 TCTCCAGACAGCCCACCCTCAGG - Intergenic
936161291 2:110085926-110085948 TCTCCATCAGGGCCTCCCTGGGG + Intronic
936183372 2:110285428-110285450 TCTCCATCAGGGCCTCCCTGGGG - Intergenic
936247572 2:110842040-110842062 CCTCCCAAAGTGCCACCCTGTGG + Intronic
936579549 2:113685902-113685924 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
936834431 2:116690283-116690305 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
937213313 2:120292373-120292395 ACTCCACAACAGCCACCCTGGGG - Intronic
937473282 2:122191659-122191681 GCACTAGAAGGGCCACTCTGAGG - Intergenic
937682701 2:124661535-124661557 TCCCCCGAAGGGCCTGCCTGAGG + Intronic
939387003 2:141514046-141514068 TATCCAGAATGACCACACTGAGG - Intronic
940283638 2:152012130-152012152 CCTCCAGAAGGACCTGCCTGAGG - Intronic
940316542 2:152333486-152333508 TATCCAGATGGGCAACCCTCTGG + Intergenic
943633604 2:190281149-190281171 TCTCCAGAATGGACTCTCTGTGG + Intronic
944404585 2:199368905-199368927 TCTCCAAAAAGCCAACCCTGGGG + Intronic
946404122 2:219483721-219483743 TCTCCAGCAGGGGACCCCTGAGG - Exonic
947038122 2:225883312-225883334 CCTCCAGAAGGACCTGCCTGAGG - Intergenic
947159270 2:227195723-227195745 TCTCCTGAAGGACCTGCCTGAGG - Intronic
947891332 2:233623815-233623837 TCAACAGAAGACCCACCCTGGGG + Intronic
947896275 2:233676108-233676130 TCAACAGAAGACCCACCCTGGGG + Intronic
948144744 2:235699912-235699934 TCCCCAGAAGAACCAGCCTGAGG - Intronic
948685094 2:239665338-239665360 CCTTCACAGGGGCCACCCTGTGG - Intergenic
948685122 2:239665416-239665438 CCTTCACAGGGGCCACCCTGTGG - Intergenic
948685150 2:239665494-239665516 CCTTCACAGGGGCCACCCTGTGG - Intergenic
948685178 2:239665572-239665594 CCTTCACAGGGGCCACCCTGTGG - Intergenic
948685206 2:239665650-239665672 CCTTCACAGGGGCCACCCTGTGG - Intergenic
1169843847 20:9968382-9968404 TCTCCAGCAGGGCCTCCCATTGG + Intergenic
1171194986 20:23189854-23189876 TCCCCAGAAGGACCACCTGGAGG - Intergenic
1172323124 20:34012547-34012569 TCTCAAGAAGGGCAACAGTGAGG - Intronic
1172738314 20:37145773-37145795 CCTCCTGAAGGGCCTGCCTGGGG + Intronic
1173194781 20:40905310-40905332 TGTCCATAAGGGATACCCTGAGG - Intergenic
1174067930 20:47878989-47879011 TCCCCATATGGGCCATCCTGTGG - Intergenic
1174535521 20:51248309-51248331 TGTCCTGAAGGGCCAGCCTGGGG + Intergenic
1175515698 20:59568495-59568517 CCTCCAGATGGGCCATCCTCAGG + Intergenic
1179468865 21:41597373-41597395 TTCCCAGAAGGAGCACCCTGAGG - Intergenic
1179580700 21:42342047-42342069 CCTCCTGAAGGGCCCGCCTGAGG + Intergenic
1179811006 21:43869700-43869722 ACTCACGCAGGGCCACCCTGGGG - Intronic
1179831752 21:44001272-44001294 TCTCCACGATGGCCGCCCTGGGG - Intergenic
1180868252 22:19132077-19132099 TATCCAGAAGGAGCACCGTGTGG + Exonic
1180921763 22:19524877-19524899 TCTCCAGAAAGCCCGCCCCGGGG + Intronic
1181936110 22:26440086-26440108 TCTCAGGAAGGCCCACCCAGGGG - Intronic
1183080895 22:35455694-35455716 TCTGCAGAAGGGAGAACCTGGGG + Intergenic
1183469025 22:37996104-37996126 TCTGGAGCAGGGACACCCTGGGG + Intronic
1183515148 22:38261220-38261242 TCTGGAGAAGGGCCAGGCTGTGG - Intronic
1184797444 22:46740317-46740339 CCTCCAGGAGGCCAACCCTGTGG + Intergenic
1185182811 22:49372893-49372915 CCTCCAGCAGGGCCACCCAATGG - Intergenic
949510412 3:4761989-4762011 ATTCCAGAAGGCCCTCCCTGAGG + Intronic
949555155 3:5146300-5146322 TGTCCAGACCTGCCACCCTGTGG - Intronic
951561698 3:23974050-23974072 TCTCCTGAAGGACCTGCCTGAGG + Intronic
952821201 3:37487374-37487396 TCTCCAGCAGGGCCTCTCTGGGG + Intronic
956247069 3:67195834-67195856 ACTCCTGAAGGGCCTGCCTGAGG - Intergenic
956726047 3:72157259-72157281 TGGCCAGAAGGGCCAACCAGTGG + Intergenic
956896063 3:73661172-73661194 TCTCCTGAAGGACCTACCTGAGG + Intergenic
957193247 3:77038526-77038548 TCTCCAGAAGGGGCCGTCTGAGG - Intronic
958168050 3:89902548-89902570 TCTCCAGAAGGACTGGCCTGAGG + Intergenic
959396911 3:105852145-105852167 CCTCCTGAAGGGCCTGCCTGAGG - Intronic
962308793 3:134311682-134311704 CTTCCAGAAGGCCCACCCAGAGG + Intergenic
962630184 3:137267957-137267979 CCTCCAGAATGGCCAACCAGTGG + Intergenic
964749859 3:160044260-160044282 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
965778221 3:172255946-172255968 TGCCCAGAAGGGCCACCTTATGG + Intronic
966499064 3:180617418-180617440 TCTCCTGAAGGACCTGCCTGAGG - Intronic
967073431 3:185981750-185981772 TCTCCACATGGGGGACCCTGAGG - Intergenic
968193795 3:196690477-196690499 TCTCCCGAAGGGTCTGCCTGCGG + Intronic
968255722 3:197269043-197269065 CCTCCTGAAGGGCCTGCCTGAGG + Intronic
968445778 4:651358-651380 TTTCCAGGAGGCCCCCCCTGAGG - Intronic
969298752 4:6285058-6285080 TGTCCAAAAGGGCTGCCCTGCGG + Intronic
969859092 4:10021648-10021670 TCTCCAGGATTGCCACCCAGGGG + Intronic
970889060 4:21021759-21021781 CCTCCTGAAGGGCCTCCCTGAGG + Intronic
976179841 4:82388644-82388666 TCCCCAGAAGGGCCACAGGGTGG - Intergenic
976428901 4:84939296-84939318 ACTCCAGATAGGACACCCTGAGG - Intronic
976459890 4:85298002-85298024 TGTCCTGAAGGGCCTGCCTGAGG + Intergenic
976482443 4:85560605-85560627 TCACCAGAAGGGCATACCTGGGG - Intronic
977658379 4:99551699-99551721 TCTCCTGAAGGACCTGCCTGAGG - Intronic
979194728 4:117906920-117906942 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
980433189 4:132730792-132730814 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
980515571 4:133854175-133854197 CCTCCAGAAGGACCCGCCTGAGG - Intergenic
981751852 4:148099902-148099924 TTTCCAGAAAGATCACCCTGTGG + Intronic
981811323 4:148778961-148778983 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
981927456 4:150155571-150155593 CCTCCAGAGGGGACTCCCTGAGG - Intronic
982205865 4:152996745-152996767 TTTCCAGAAAGTTCACCCTGTGG + Intergenic
982587256 4:157258341-157258363 TCTCTAAAACGGCCACTCTGGGG + Intronic
985138079 4:186809316-186809338 CCTCCTGAAGGGCCTGCCTGAGG + Intergenic
986337609 5:6766940-6766962 TCTACAGGAGCCCCACCCTGAGG + Intergenic
987593210 5:19960511-19960533 TCTCCTGAAGGACCTGCCTGAGG + Intronic
987987545 5:25167664-25167686 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
991577710 5:68122323-68122345 TCTCCAGAAGGGTGGCCCTATGG + Intergenic
992407972 5:76477684-76477706 CCTCCAAAAGGGCCTGCCTGGGG - Intronic
992517961 5:77515449-77515471 TCTCCTGAAGGATCAGCCTGAGG + Intronic
993567624 5:89494355-89494377 TCTCCTGAAGGACCTTCCTGCGG - Intergenic
998162529 5:139821713-139821735 ACTCCAGAGTGGCCATCCTGGGG + Intronic
998212757 5:140213074-140213096 TCTCCTGAAGGACCTGCCTGAGG - Intronic
998397728 5:141829854-141829876 TTTCCAGATGGGCCAGTCTGAGG - Intergenic
999215219 5:149928028-149928050 TCTCCTGAAGGACCTGCCTGAGG + Intronic
1000051902 5:157570753-157570775 TCTCCAAAATGGGCACCCAGAGG + Intronic
1002805743 6:572603-572625 TTTCAACAAAGGCCACCCTGTGG + Exonic
1002807793 6:593986-594008 TCTGCAGACGGGCCACACTCAGG + Intronic
1002808631 6:603682-603704 TATCCAGAAGGGCCAGGATGTGG - Intronic
1002938966 6:1699365-1699387 TCTCCAGGAGGGCCTAACTGTGG + Intronic
1003125387 6:3351715-3351737 GCTCCATAGGGCCCACCCTGTGG - Intronic
1005343117 6:24862194-24862216 GCAGCAGAAGGGCCTCCCTGGGG - Intronic
1005751737 6:28889533-28889555 TCTCCAGAAGATCCACACTGGGG - Intergenic
1005867563 6:29947551-29947573 CCTCCACAAGACCCACCCTGAGG - Intergenic
1005976861 6:30806796-30806818 ACTCCAGAAGCGCCACCTTAAGG - Intergenic
1006125797 6:31837166-31837188 TCTCCAGAAGGGCCAATGGGAGG + Intronic
1006629271 6:35419698-35419720 TCTCCATATGGGCCACACGGTGG + Intronic
1006925567 6:37652428-37652450 TCCCCAGAAGGGCCAGCTAGAGG - Intronic
1007373593 6:41442353-41442375 TCCCCACAGGGGCCACCCTGAGG + Intergenic
1009979551 6:70711052-70711074 CCTCCTGAAGGGCCTACCTGAGG + Intronic
1011456764 6:87558874-87558896 TCTCCTGAAGGACCTGCCTGAGG - Intronic
1012209767 6:96505541-96505563 TTTCCAGAAGGGCAACAATGTGG + Intergenic
1012533977 6:100273347-100273369 TCTCCTGAAGGACCAGCCTGAGG - Intergenic
1012543990 6:100395714-100395736 TCACCACTAGGCCCACCCTGTGG + Intronic
1014052920 6:116976746-116976768 TCTCCTGAAGGACCTGCCTGAGG - Intergenic
1017669266 6:156754680-156754702 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1018041601 6:159928875-159928897 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1019413306 7:916032-916054 TCCCCAGAAGGGCCACTCCAGGG + Intronic
1020156404 7:5728200-5728222 TCTCCAGAAGGGCCACCCTGAGG - Intronic
1022500934 7:30882072-30882094 TCTTCAGCAGGGCCTCTCTGAGG + Intronic
1022653418 7:32297619-32297641 CCTCCAGAGGGTCAACCCTGTGG + Intronic
1023248094 7:38228344-38228366 GATCCAGAAGGGCCAGACTGTGG + Intronic
1023308683 7:38858905-38858927 CCTCCAGAAGGACCTGCCTGAGG - Intronic
1025849608 7:65235378-65235400 TCTGCAGAAAGCCCACCCTAGGG + Intergenic
1026903852 7:74051606-74051628 TCTCCAGATGGGCCTGTCTGGGG - Intronic
1027542065 7:79479192-79479214 TCTGCAGAAGATCCAGCCTGAGG + Intergenic
1028601891 7:92610077-92610099 TCTCTAAAAGTGCCACCTTGTGG + Exonic
1028977238 7:96927561-96927583 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1029790374 7:102837236-102837258 TCTCCAGGAGGGGCACCTTCAGG - Intronic
1029860313 7:103564489-103564511 TCACCTGGAGGGCCACCCAGGGG + Intronic
1031979510 7:128115736-128115758 TCTCCTGATGATCCACCCTGTGG + Intergenic
1032461366 7:132113938-132113960 CCACCAGGGGGGCCACCCTGGGG + Intergenic
1033170280 7:139077850-139077872 TCTCAAGTAGGGCCACTCTATGG - Intronic
1034478071 7:151300173-151300195 CCACCAGGAGGGGCACCCTGTGG + Intergenic
1035957984 8:4104026-4104048 TGCCCAGAAGGGCCAGGCTGGGG - Intronic
1036193819 8:6696705-6696727 TCTCCTGAAGGACCTCACTGAGG + Intergenic
1036444974 8:8813376-8813398 CCTCCCGAAGGGCCTGCCTGAGG - Intronic
1039722512 8:40179828-40179850 TTTCCAGTAGGGCCACCAGGAGG - Intergenic
1040004384 8:42607183-42607205 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
1040016762 8:42706491-42706513 TCTCCACCGGGGCCACGCTGAGG - Intronic
1040477639 8:47794438-47794460 TGTCCAGTAAGGCCACCATGTGG + Exonic
1040934529 8:52768596-52768618 TCTTCACAAGGGACTCCCTGAGG + Intergenic
1044995281 8:97832296-97832318 TCTTCAGAAGGGCTACCAGGTGG + Intronic
1045711038 8:104984304-104984326 TATCCAGAAAGGCTACTCTGGGG + Intronic
1047213236 8:122856720-122856742 TCTTTAGAAGGGCCACCATAGGG - Intronic
1048751686 8:137684238-137684260 TCTCCTGAAGGACCTGCCTGAGG + Intergenic
1049005948 8:139855769-139855791 TCTTCACAAGGGCGGCCCTGAGG - Intronic
1049497348 8:142942497-142942519 TCAGCAGAAGGTCCAGCCTGGGG + Intergenic
1049811455 8:144575636-144575658 CCTCCAGAAGGACCCACCTGAGG + Intronic
1050139553 9:2503094-2503116 TCTTCAGTAGGGCCACTCTAGGG + Intergenic
1052953671 9:34234895-34234917 TCTCCTGAAGGACCTACCTGAGG - Intronic
1053427362 9:38019293-38019315 TCTCCAGGAGGACAAACCTGTGG - Intronic
1055340192 9:75273254-75273276 TCTCCAAAATGGCCGCTCTGGGG - Intergenic
1056432030 9:86537385-86537407 CCTCCTGAAGGGCCTGCCTGAGG - Intergenic
1057225215 9:93289371-93289393 TGTCCACAAAGCCCACCCTGGGG - Exonic
1057937598 9:99253887-99253909 TCCCCTGCAGGCCCACCCTGTGG - Intergenic
1058641151 9:107086803-107086825 TCTCCAGAAAGGCCAATGTGAGG - Intergenic
1061315712 9:129794553-129794575 TCTGCAGAATAGCCCCCCTGGGG + Intergenic
1061747928 9:132753649-132753671 GCCCCAGCTGGGCCACCCTGGGG - Intronic
1061924955 9:133801450-133801472 TCTGCAGAGGCGTCACCCTGGGG - Intronic
1203654227 Un_KI270752v1:7860-7882 ACTCCAGACTGGCCACCTTGGGG - Intergenic
1185738067 X:2508227-2508249 CCCCCTGAAGGGCCACACTGTGG - Intergenic
1186437102 X:9552089-9552111 TCCTCAGATGGGCCACCCTTTGG + Intronic
1186453560 X:9692846-9692868 TCTCCAGAAGAACTACCTTGGGG - Intronic
1186841134 X:13485705-13485727 TCTCCACCATGGCCACCCTCAGG + Intergenic
1192562157 X:72134318-72134340 TCACCAGCAGAGCTACCCTGAGG + Intronic
1195424300 X:104710996-104711018 TCTCCTGAAGGACCCACCTGAGG - Intronic
1198193453 X:134334818-134334840 TCTCCAGAAGGGCTTGCCTGAGG + Intergenic
1198231236 X:134691637-134691659 TTTCCAGAAGGGCCGTCCTAAGG - Intronic
1198797197 X:140410156-140410178 TCTCAGGAAGGCCCACCCTAGGG - Intergenic
1200125596 X:153812757-153812779 TCATCAGAAGGGCCACAGTGTGG - Intronic
1200142766 X:153910069-153910091 TCTCCAGCTGGGCGTCCCTGAGG + Exonic