ID: 1020157614

View in Genome Browser
Species Human (GRCh38)
Location 7:5739507-5739529
Sequence CTATGTAGACAGATGAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 244}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020157614_1020157617 -4 Left 1020157614 7:5739507-5739529 CCCAGATTCATCTGTCTACATAG 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1020157617 7:5739526-5739548 ATAGAAGATGAGGTCTAGAAAGG 0: 1
1: 0
2: 0
3: 35
4: 300
1020157614_1020157618 11 Left 1020157614 7:5739507-5739529 CCCAGATTCATCTGTCTACATAG 0: 1
1: 0
2: 1
3: 22
4: 244
Right 1020157618 7:5739541-5739563 TAGAAAGGTCTTGAGAGATCTGG 0: 1
1: 0
2: 3
3: 33
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020157614 Original CRISPR CTATGTAGACAGATGAATCT GGG (reversed) Intronic
901943460 1:12681847-12681869 ATATGTAGAGAGCTGAAACTGGG + Intergenic
905030034 1:34876130-34876152 ATCTGTGGACAGATGAATCTTGG + Intronic
909042136 1:70667270-70667292 CTTTGAAGACAGATAGATCTGGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
911091142 1:94018142-94018164 CTATGGAGAGAGATGTAGCTAGG - Intronic
913647428 1:120872055-120872077 ATATGTAGAGAGCTGAAACTGGG - Intergenic
914079211 1:144390805-144390827 ATATGTAGAAAGCTGAAACTGGG + Intergenic
914099968 1:144575697-144575719 ATATGTAGAAAGCTGAAACTGGG - Intergenic
914174114 1:145259352-145259374 ATATGTAGAGAGCTGAAACTGGG + Intergenic
914299021 1:146361984-146362006 ATATGTAGAAAGCTGAAACTGGG + Intergenic
914528778 1:148500536-148500558 ATATGTAGAGAGCTGAAACTGGG + Intergenic
914637616 1:149566572-149566594 ATATGTAGAAAGCTGAAACTGGG - Intergenic
915181832 1:154068379-154068401 ATATGTAGAAAGCTGAAACTGGG + Intronic
916326214 1:163562716-163562738 CTATGTAGACAGATTAAGAAGGG - Intergenic
918279528 1:182990342-182990364 CAATGTATACAGATAACTCTAGG - Intergenic
919229605 1:194757185-194757207 ATATGTAGAAAGCTGAAACTGGG - Intergenic
920065011 1:203262897-203262919 ATATGTAGAAAGCTGAAACTGGG + Intronic
920576934 1:207068376-207068398 CTATTTAGACAGTTTTATCTAGG + Intronic
922382989 1:225052180-225052202 CTTTGAATACAGATGAATATTGG + Intronic
923701526 1:236304261-236304283 CTCTGTGGACAGGTAAATCTGGG - Intergenic
923747753 1:236718471-236718493 TTATGAAGACAGATGGATCAGGG - Intronic
924181492 1:241443084-241443106 ATATTTAGACAGATAAATGTTGG - Intergenic
1065221279 10:23498784-23498806 CTAAGCAGACAGATAAATCTTGG - Intergenic
1067280844 10:44871432-44871454 CTATGTTCACACATTAATCTGGG + Intergenic
1074236395 10:111588729-111588751 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1074337738 10:112595106-112595128 ATATGTAGAAAGCTGAAACTGGG + Intronic
1075582142 10:123627994-123628016 CCATGTACAAAGATGAAACTTGG - Intergenic
1080140577 11:28914375-28914397 GTATGTATACATATGAATATAGG + Intergenic
1080847149 11:36036423-36036445 CTGTGTAGACACAGGGATCTTGG + Intronic
1080900223 11:36482778-36482800 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1081300948 11:41450502-41450524 CTTTGTAGACAGACGCAACTAGG + Intronic
1081511584 11:43779506-43779528 AGAGGAAGACAGATGAATCTGGG - Intronic
1082207244 11:49452606-49452628 CCAAGTAGTCAGTTGAATCTTGG - Intergenic
1083008917 11:59375634-59375656 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1085820564 11:79788757-79788779 CTTTGTAGTCAGCTGGATCTAGG - Intergenic
1086357431 11:86018125-86018147 TTTTTTAGTCAGATGAATCTAGG - Intronic
1086648033 11:89249127-89249149 CCAAGTAGTCAGTTGAATCTTGG + Intronic
1089330558 11:117686166-117686188 CTATGTGGAGAGATGGAGCTGGG + Intronic
1089877945 11:121744094-121744116 CTATGTAGACACAGGAATCTAGG - Intergenic
1093254821 12:16854064-16854086 GTATGTAGACAGATTAAACTTGG + Intergenic
1093558659 12:20510650-20510672 CCATGTTGACAGATCCATCTGGG - Intronic
1094791089 12:33916107-33916129 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1095408164 12:41890833-41890855 CATTGTAGAAAGATTAATCTGGG - Intergenic
1096317968 12:50585371-50585393 CCTTGTAGACAGATGAAGCGTGG + Intronic
1097121020 12:56732490-56732512 TTATCTAGAAAGATAAATCTGGG - Intronic
1097309737 12:58105479-58105501 CTGTGTAGACAGATGATGCTGGG + Intergenic
1097530432 12:60793117-60793139 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1098007108 12:66009084-66009106 CTTTGGAGTCAGATGTATCTTGG - Intergenic
1098695685 12:73551458-73551480 CTATGTAGTCAGAGCAATCAAGG + Intergenic
1100075230 12:90772872-90772894 CCATGTAGACAGAGAACTCTGGG - Intergenic
1101222514 12:102656095-102656117 CCGTGCAGGCAGATGAATCTTGG + Intergenic
1101768584 12:107727051-107727073 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1101814481 12:108135344-108135366 TTATGGAGGCAGATGAAGCTGGG + Intronic
1102333547 12:112057474-112057496 CTATGCAGCCTCATGAATCTAGG + Intronic
1102856819 12:116301396-116301418 CTTTGTAGTCAGAGGGATCTGGG + Intergenic
1103232930 12:119347120-119347142 TTATTTAGAAAGATGAGTCTAGG - Intronic
1104204868 12:126629038-126629060 GTATGGAGACAGATTAATTTTGG - Intergenic
1106348947 13:28908885-28908907 ATATGTAGAAAGCTGAAACTGGG - Intronic
1109005252 13:56866782-56866804 CTATGTAGATAGATATATTTTGG + Intergenic
1109745602 13:66619673-66619695 CTATGGAGTCAGATTAACCTAGG - Intronic
1111808108 13:93063789-93063811 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1115475410 14:33808647-33808669 CTATGTACACAGAGGAAGATGGG - Intergenic
1115984886 14:39094709-39094731 ATATGGAGACAGAAGAATCCGGG + Intronic
1117099178 14:52328381-52328403 AAATATAGACAGATGAATTTTGG - Exonic
1119943687 14:78668979-78669001 CTAGGTAGACAGATAGATCTAGG - Intronic
1120362530 14:83523956-83523978 CTATGTAGTGAAATGGATCTGGG + Intergenic
1121210080 14:92201896-92201918 CAAAGGAGACCGATGAATCTGGG + Intergenic
1122009970 14:98738190-98738212 CTCTGAAGAGAGATCAATCTGGG - Intergenic
1123430091 15:20207400-20207422 CTATGTAGACAGAAACATCTAGG + Intergenic
1123890134 15:24769238-24769260 ATATGTGGACATATGAATTTAGG + Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1125714892 15:41813901-41813923 CTCTTTAGACAGAAGAATTTGGG + Intronic
1128759632 15:70207358-70207380 CTATGAAGTCAGATGGATCTGGG + Intergenic
1128888071 15:71306437-71306459 CTTTGAAGAAAGATAAATCTGGG - Intronic
1129139659 15:73585937-73585959 CTATGAAGAAAGATGCCTCTAGG + Intronic
1131370871 15:91880789-91880811 CTATTTAAACAGAAGTATCTGGG + Intronic
1133679330 16:8106166-8106188 CTAGGTAAACAGAGCAATCTAGG - Intergenic
1133938504 16:10287923-10287945 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1134389394 16:13805359-13805381 ATATGTAGTCGGATGAATTTTGG - Intergenic
1135178188 16:20250163-20250185 CCATGTAGACAGCTAAAACTCGG - Intergenic
1136854545 16:33643807-33643829 CTATGTAGACAGAAACATCTAGG - Intergenic
1137461684 16:48670314-48670336 CTTTGTGCACAGATGGATCTAGG - Intergenic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1138804340 16:60076631-60076653 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1139009256 16:62612227-62612249 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1141044337 16:80703028-80703050 ATATATACACACATGAATCTAGG + Intronic
1141246341 16:82311362-82311384 CTATGGAGAAAGATGAAAGTAGG - Intergenic
1141258112 16:82422512-82422534 ATATGTAGACAGATGGATAATGG + Intergenic
1203116124 16_KI270728v1_random:1492270-1492292 CTATGTAGACAGAAACATCTAGG - Intergenic
1145283520 17:21486442-21486464 CTATGTAAGCAGATAAATCTTGG - Intergenic
1146226783 17:31073985-31074007 CTATATATACTAATGAATCTTGG + Intergenic
1146546187 17:33740840-33740862 CTATATAGGAAAATGAATCTAGG + Intronic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1148171581 17:45525445-45525467 CTAAGTACAAAGATGATTCTTGG - Intergenic
1148255261 17:46125527-46125549 CTATATGGACAGATGTATTTGGG - Intronic
1148277790 17:46320961-46320983 CTAAGTACAAAGATGATTCTTGG + Intronic
1148299997 17:46538816-46538838 CTAAGTACAAAGATGATTCTTGG + Intronic
1148364441 17:47043104-47043126 CTAAGTACAAAGATGATTCTTGG + Intronic
1148949268 17:51295395-51295417 ATATGTAGAAAGCTGAAACTGGG - Intronic
1149507428 17:57205940-57205962 GGATGTAGACAAATGATTCTAGG + Intergenic
1150402507 17:64870481-64870503 CTAAGTACAAAGATGATTCTTGG - Intronic
1154188045 18:12203641-12203663 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1155247130 18:23921336-23921358 CTATGTATATAAATGAATCTGGG + Intronic
1156460018 18:37316379-37316401 CCATGCAGACAGATGACTCCTGG + Intronic
1157073042 18:44432041-44432063 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1159337664 18:67090755-67090777 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1160055488 18:75475570-75475592 CTCTATAAACAGATGAATCCTGG - Intergenic
1161215986 19:3095249-3095271 CAATGTAGACAGCAGAAGCTGGG - Intronic
1163177735 19:15576247-15576269 TTATGTAGACAGAGGAAGCAAGG + Intergenic
926229936 2:10994667-10994689 CTATGGAGAAATATGAAGCTGGG - Intergenic
926727048 2:16006680-16006702 CTTTGGAGGCAGATGAGTCTGGG + Intergenic
927337031 2:21937101-21937123 CTATTAAGGCAGATAAATCTGGG + Intergenic
928717109 2:34073865-34073887 CTATTCAGCCAGACGAATCTTGG - Intergenic
929003751 2:37375002-37375024 CTATGTTGTCAGGTGAATCGTGG - Intergenic
930859421 2:56054389-56054411 ATATGCAGACAAATGTATCTTGG - Intergenic
933180834 2:79225328-79225350 CTATGTATACAGTAGTATCTGGG + Intronic
933512911 2:83263664-83263686 CTGGGTAGACATATAAATCTAGG + Intergenic
937204190 2:120225133-120225155 CTATGTAGTCAGATGAACTCAGG + Intergenic
938972219 2:136443062-136443084 CCATATAGACAGATGAGACTAGG + Intergenic
941186090 2:162323604-162323626 ATATGTAGAAAGCTGAAACTGGG - Intronic
942033652 2:171989387-171989409 ATTTGTAGACTGATAAATCTGGG - Intronic
942587284 2:177495438-177495460 CTTTGTAGTCAGACAAATCTGGG - Intronic
943534409 2:189129432-189129454 CTATTTTGAGAGATGATTCTGGG + Intronic
945460463 2:210101986-210102008 ATATGTAGAAAGCTGAATCTAGG - Intronic
948624068 2:239256944-239256966 CTAAGAAGACAGAAGAACCTGGG + Intronic
948624075 2:239257035-239257057 CCATGTAGACAAATAACTCTGGG + Intronic
1171302101 20:24072102-24072124 CAAAATAAACAGATGAATCTTGG - Intergenic
1171443092 20:25182032-25182054 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1177421999 21:20871601-20871623 CTAAGTAGATATATGAATTTGGG - Intergenic
1177717105 21:24853094-24853116 CTTTGGAGACAGAGGCATCTTGG - Intergenic
1178174232 21:30077801-30077823 CTAGTTAGAAAGATGAATTTTGG + Intergenic
1181866425 22:25860028-25860050 ATATGCAGAAAGATGAATATAGG - Intronic
1182017560 22:27053334-27053356 CTATGAAGGCAAATGAATCAGGG - Intergenic
1183877263 22:40794054-40794076 AGATGTTAACAGATGAATCTGGG + Intronic
1184874757 22:47267195-47267217 CCATGAAGACAGATGCATATGGG - Intergenic
949526037 3:4905111-4905133 TTTTGAAGACAGTTGAATCTGGG + Intergenic
951292059 3:20883340-20883362 CTATGAAAATAGCTGAATCTGGG - Intergenic
952539096 3:34347272-34347294 CTATGAAGACAGAGGCATATGGG - Intergenic
953074513 3:39556143-39556165 ATATGTAGAAAGCTGAAACTGGG + Intergenic
953720001 3:45346931-45346953 TTCTGTAGTCAGATGTATCTAGG + Intergenic
955742399 3:62105805-62105827 CTACGTTGACATATGAATGTTGG - Intronic
956044008 3:65175874-65175896 CTTTGTAGTCAAATAAATCTGGG + Intergenic
959169266 3:102824980-102825002 ATATGTAGAAAGCTGAAACTGGG + Intergenic
959250307 3:103933419-103933441 CTATGTAGAAAGCTGAAACTGGG + Intergenic
962084024 3:132171966-132171988 CTCTGTAGACCCATGGATCTGGG - Intronic
962675619 3:137755642-137755664 ATATGTAGAAAGCTGAAACTGGG + Intergenic
962682000 3:137810008-137810030 CTGTGAAGACAAATGGATCTTGG - Intergenic
963588749 3:147229027-147229049 ATATGTAGAAAGCTGAAACTGGG - Intergenic
963699276 3:148603950-148603972 CTATGTAGACAGATAAAGATGGG + Intergenic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964451009 3:156813299-156813321 CTGTGTTGGCAGATGAAGCTAGG + Intergenic
964994406 3:162857343-162857365 ATATGTACACTGATGAATGTGGG - Intergenic
965053121 3:163677257-163677279 TTATGTAGACAGATAGATTTAGG - Intergenic
967149804 3:186638209-186638231 CTGTGGAGATAGATCAATCTAGG - Intronic
967858005 3:194132942-194132964 GGATGTAGACAGATGCCTCTGGG + Intergenic
971712642 4:30136152-30136174 CTGTGAGGCCAGATGAATCTTGG - Intergenic
973633205 4:52838684-52838706 CCATGAAGCCAGATGAAACTGGG - Intergenic
973671263 4:53220175-53220197 CTATGAAGAAAAATGAAGCTGGG - Intronic
974123193 4:57664473-57664495 ATATGTAGAAAGCTGAAACTGGG - Intergenic
974151218 4:58011862-58011884 CTCTGTAGATAGATTAATTTGGG - Intergenic
974564681 4:63567400-63567422 TTCAGAAGACAGATGAATCTTGG + Intergenic
976852998 4:89570214-89570236 CAAAGTAGACTGATGAATTTTGG + Intergenic
977279166 4:95017584-95017606 TTTCCTAGACAGATGAATCTTGG + Intronic
977455576 4:97255794-97255816 ATATGTAGAAAGCTGAAACTGGG - Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
980390090 4:132133671-132133693 ATATGTAGAAAGCTGAAACTGGG + Intergenic
980426050 4:132629268-132629290 ATATGTAGAAAGTTGAAACTGGG + Intergenic
980591334 4:134893294-134893316 CTATGTATACACATGCATTTGGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
982317097 4:154042997-154043019 CTTCGTAGTCAGGTGAATCTGGG - Intergenic
982480267 4:155900352-155900374 CTATGTTTACAGATGCTTCTTGG + Intronic
983311058 4:166061913-166061935 ATATGTAGAAAGCTGAAACTGGG - Intronic
983899730 4:173121035-173121057 CTATGTAGACATTTAAATTTTGG + Intergenic
985180839 4:187260113-187260135 ATATGTAGGAAGATGAAGCTAGG + Intergenic
986647262 5:9929765-9929787 CTTTGCAGAAAGATGAATGTGGG - Intergenic
988072229 5:26307368-26307390 ATATGTAGAAAGCTGAAACTGGG + Intergenic
988506770 5:31830588-31830610 CTGTGATGACAGAGGAATCTGGG - Intronic
988953733 5:36292596-36292618 ATATGTAGAAAGCTGAAACTGGG - Intronic
990105035 5:52247913-52247935 ATATGTAGAAAGCTGAAACTGGG - Intergenic
990136948 5:52657111-52657133 CTATGTGGACTGATGCTTCTTGG - Intergenic
991044566 5:62209555-62209577 CTATGTACTCAGAAGAGTCTGGG - Intergenic
991047323 5:62236369-62236391 CTATGTAGACAGAAACATCTAGG + Intergenic
991617749 5:68514863-68514885 ATTTGTAGAGAGAAGAATCTGGG + Intergenic
993068391 5:83129171-83129193 ATATGTAGAAAGCTGAAACTGGG - Intronic
994560449 5:101364347-101364369 TTATGTAGAAAGTAGAATCTAGG - Intergenic
995059497 5:107797900-107797922 TTATGTAGAGAGATGACCCTTGG - Intergenic
996657792 5:125962196-125962218 ATATATAGACAGATAAATGTAGG + Intergenic
998512049 5:142721783-142721805 CTATATAGACAGCTCTATCTAGG + Intergenic
999008666 5:148010167-148010189 CTTTGGAGACAGAAGAGTCTGGG + Intergenic
999693490 5:154168573-154168595 CTCTGCAAACAGCTGAATCTTGG + Intronic
999803518 5:155060064-155060086 ATATGTAGAAAGCTGAAACTGGG - Intergenic
999821167 5:155230315-155230337 CTGTGTACACAGATGATTGTAGG + Intergenic
1000023046 5:157335534-157335556 CTATGTATACAAAAGACTCTTGG - Intronic
1001235994 5:170030016-170030038 ATATGGAGACTGATGTATCTGGG + Intronic
1001371910 5:171212816-171212838 CCAAGTAGACATATGAATATAGG - Intronic
1001694991 5:173663460-173663482 CTCTGTAGTCAGAAGGATCTAGG - Intergenic
1001806884 5:174594324-174594346 ATATGTAGACAGAGGAATGTGGG + Intergenic
1006407513 6:33853828-33853850 ATTTGAAGCCAGATGAATCTAGG + Intergenic
1009064782 6:58445904-58445926 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1009921337 6:70065403-70065425 GTATGTAGAAAGCTGAAACTGGG + Intronic
1011670231 6:89676300-89676322 CTATTCAGACAGCTGACTCTTGG - Intronic
1012187350 6:96235648-96235670 CTTTGGAGTCAGATGAATCTGGG - Intergenic
1012546023 6:100420421-100420443 CGATGTAGAAAAATGCATCTTGG - Intronic
1013222331 6:108089956-108089978 TTATGTATACATATAAATCTTGG + Intronic
1013844620 6:114434653-114434675 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1014396951 6:120935602-120935624 CTGTGGAGACAGAACAATCTCGG + Intergenic
1016003461 6:139066371-139066393 CTATGTAGACTGTTTCATCTTGG - Intergenic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1018222190 6:161592638-161592660 CTATGGAGAAAGATGAAGCAGGG + Intronic
1020157614 7:5739507-5739529 CTATGTAGACAGATGAATCTGGG - Intronic
1023464936 7:40443918-40443940 ATATGTAGAAAGCTGAAACTGGG - Intronic
1024653819 7:51432210-51432232 CTTTGTAGCCAGAAGAATCTTGG - Intergenic
1025153174 7:56576635-56576657 CTGTGTTGACAGATCAGTCTGGG + Intergenic
1027667347 7:81056492-81056514 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1028537375 7:91904875-91904897 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1028956022 7:96691452-96691474 CTATTTAGCCATATGAACCTTGG - Intronic
1031252036 7:119396437-119396459 CTATTTAAGCAGATGAATGTTGG - Intergenic
1032012882 7:128358421-128358443 GGATGTAGACAGATGTATCAGGG - Intronic
1032455874 7:132072992-132073014 CTATCTAGACAGAGGGCTCTAGG + Intergenic
1033057636 7:138074299-138074321 CTATGTAAACAGATCAATTTTGG - Intronic
1034483013 7:151337672-151337694 CTATTGAGACAAATGAACCTGGG - Intergenic
1035654023 8:1292072-1292094 CTCTGAAGACAGATGAATTGTGG + Intergenic
1037221934 8:16534186-16534208 ATATTTACACAGATGAATCGGGG - Intronic
1040921588 8:52626523-52626545 AAATGTTAACAGATGAATCTGGG + Intronic
1041162014 8:55054783-55054805 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1042672491 8:71280156-71280178 CTTTGTAGTCAGCTGAATCTAGG + Intronic
1042820662 8:72926721-72926743 CTATGGAGATAGAAGGATCTAGG - Intronic
1043046381 8:75329016-75329038 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1043084183 8:75807336-75807358 ATATTTAGACATATGATTCTTGG - Intergenic
1043465531 8:80502825-80502847 CTATGTAAACAAATGAAGGTAGG + Intronic
1044168817 8:89023489-89023511 ATATGCAGAAAGATGAAACTGGG - Intergenic
1046233657 8:111392195-111392217 CTATTTTGACAGAAAAATCTGGG - Intergenic
1048110872 8:131466853-131466875 CTTCGTTGACAGATGAAACTTGG - Intergenic
1049061602 8:140280307-140280329 CTGTTTAGAAAGATGAATTTTGG - Intronic
1051299477 9:15632967-15632989 ATATGTAGAAAGCTGAAACTGGG + Intronic
1051954775 9:22678700-22678722 CTATGAAGACATAAGAATCAAGG - Intergenic
1052145259 9:25041164-25041186 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1053521468 9:38784299-38784321 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1055382662 9:75725841-75725863 TTTTATAGACAGATGAATTTAGG - Intergenic
1055804816 9:80081040-80081062 GGAGGTAGACAGATGATTCTTGG + Intergenic
1058775060 9:108274727-108274749 CTATGGAGACAGATCACACTGGG - Intergenic
1059964855 9:119603533-119603555 CTAGGTACAGAGATGAATCCAGG - Intergenic
1060332955 9:122692548-122692570 ATATGCAGACAAATGAAACTGGG + Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1187983446 X:24784349-24784371 CTATTTAGAAATATAAATCTTGG - Intronic
1188188743 X:27147871-27147893 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1188273754 X:28176244-28176266 CTAAGAAGCCAGATGAAACTGGG - Intergenic
1188306754 X:28568599-28568621 CAGTGAAGACAGATGAATCAGGG - Intergenic
1191193222 X:57689196-57689218 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1191196255 X:57726672-57726694 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1191218238 X:57955555-57955577 ATATGTAGAAAGACGAAACTGGG + Intergenic
1191753795 X:64572233-64572255 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1191761149 X:64649874-64649896 ATATGTAGAAAGCTGAAACTGGG + Intergenic
1192280317 X:69678017-69678039 ATATGTAGAAAGCTGAAACTGGG - Intronic
1193384945 X:80858712-80858734 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1194631739 X:96293716-96293738 ATATGCAGACAGCTGAAACTAGG + Intergenic
1195619118 X:106935548-106935570 CTCTGGAGTCAGATGAATCTGGG + Intronic
1196688945 X:118538265-118538287 TAATGTAGACAGATGAACTTAGG + Intronic
1196727766 X:118912646-118912668 CAATGTAGACAGATACATATGGG - Intergenic
1197055922 X:122118589-122118611 CTATGCAGTCAGATAAATCCAGG + Intergenic
1197265562 X:124366274-124366296 CTTTGTCAACAGGTGAATCTGGG + Intronic
1197465838 X:126803807-126803829 GTATGTAGAAAGCTGAAACTGGG + Intergenic
1198484748 X:137075918-137075940 ATATGTAGAAAGCTGAAACTGGG - Intergenic
1198675990 X:139131220-139131242 CTTTGTAGCCAGATAAATCTGGG + Intronic
1199557039 X:149120781-149120803 CTTTGTAGACAATTTAATCTTGG + Intergenic
1199998764 X:153045318-153045340 ATATGCATTCAGATGAATCTTGG - Intergenic
1200883342 Y:8243479-8243501 CTCTGTAGAAAGGTGAAACTGGG + Intergenic
1201577511 Y:15477023-15477045 CTGTGAATACAGATGAAGCTTGG + Intergenic