ID: 1020189481

View in Genome Browser
Species Human (GRCh38)
Location 7:5984472-5984494
Sequence GACGTTTTCTGGTTCTCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 2, 1: 0, 2: 0, 3: 7, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020189476_1020189481 29 Left 1020189476 7:5984420-5984442 CCGCAGTATCAGCGCGGTGATGA 0: 1
1: 1
2: 0
3: 1
4: 36
Right 1020189481 7:5984472-5984494 GACGTTTTCTGGTTCTCACCTGG 0: 2
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020189481 Original CRISPR GACGTTTTCTGGTTCTCACC TGG Intronic
900440491 1:2652647-2652669 CACGATGTCAGGTTCTCACCTGG - Intronic
905503929 1:38461485-38461507 AACTTTCTCTGGATCTCACCTGG - Intergenic
908922617 1:69213838-69213860 GAGGTTTCCTGGTTGTCAGCTGG - Intergenic
911671106 1:100609122-100609144 GACATTTTCTCTTTCTCAGCAGG + Intergenic
912956996 1:114161422-114161444 GTCTTGTTCTGGTTCTCAACGGG - Intergenic
913573888 1:120149940-120149962 GTCTTATTCTGGTTCTCACAGGG + Intergenic
914295146 1:146314740-146314762 GTCTTATTCTGGTTCTCACAGGG + Intergenic
914556187 1:148765523-148765545 GTCTTATTCTGGTTCTCACAGGG + Intergenic
914616646 1:149364710-149364732 GTCTTATTCTGGTTCTCACAGGG - Intergenic
914984168 1:152442045-152442067 CACATTTGCTGTTTCTCACCTGG - Intergenic
1066762524 10:38769197-38769219 GACGGACTCAGGTTCTCACCAGG + Intergenic
1066959057 10:42203266-42203288 GACGGACTCAGGTTCTCACCAGG - Intergenic
1068301594 10:55149660-55149682 GTCGTTTTCAGGTTTTCACCAGG + Intronic
1069798150 10:71066312-71066334 GAACGTTTCTGTTTCTCACCAGG + Intergenic
1069798491 10:71068251-71068273 GAACGTTTCTGTTTCTCACCAGG - Intergenic
1071808390 10:89149952-89149974 GTCTTGTTCTGGTTCTCACTGGG + Intergenic
1077627043 11:3781426-3781448 CAGGGTTTCTGGTTTTCACCAGG + Intronic
1077952577 11:6976648-6976670 AATGCTTTTTGGTTCTCACCTGG + Intronic
1078953391 11:16161783-16161805 GACATTTTCTTGTTCTCACTTGG + Intronic
1081509798 11:43758613-43758635 GAAGTTCTCTGGTTCTCTCATGG + Intronic
1082790743 11:57345260-57345282 GGCATTTTCTGCTTCTAACCAGG - Intronic
1084867755 11:72073566-72073588 AAAGTTTTCTTGTTCTCCCCTGG - Intronic
1092997658 12:13964972-13964994 GATGCTATGTGGTTCTCACCTGG - Intronic
1093206461 12:16257293-16257315 CACTTTTTCTTCTTCTCACCCGG - Intronic
1095624214 12:44296065-44296087 GACTTTTGCTGGTTCTTACAAGG + Intronic
1096800732 12:54108736-54108758 GATGTTTTGTGGTTCTAACGAGG - Intergenic
1101715793 12:107310896-107310918 GACATTTTAAGGTTTTCACCTGG - Intergenic
1101715871 12:107311383-107311405 GACATTTTAAGGTTTTCACCTGG + Intergenic
1103839627 12:123851645-123851667 GACGTTGTGTGGATTTCACCAGG + Intronic
1104542343 12:129677718-129677740 AACGTGTTCTAGTTCTCACCTGG - Intronic
1107230801 13:38107839-38107861 GACATATTCTGGTTCTCAAGGGG - Intergenic
1107839021 13:44436719-44436741 GCCGTTTTCTGTTTCTCCCTGGG - Intronic
1116042869 14:39707035-39707057 GATGTTTCCTGGTTCTCATCTGG + Intergenic
1118138222 14:63050891-63050913 GAGGTTTTGTGGTTCTCTTCTGG - Intronic
1122318688 14:100840505-100840527 GACGTTTTCTTCTTTTCATCTGG - Intergenic
1131646281 15:94348530-94348552 AACGTCTCCTGGTTCTCACCTGG - Intronic
1133594573 16:7279342-7279364 GATATTTTCTGCTTTTCACCAGG + Intronic
1136078685 16:27837411-27837433 GATGGTTCCTGGTTCTTACCAGG + Intronic
1137489457 16:48919398-48919420 GAGGTGTTCTGCTTCTCACATGG - Intergenic
1138079764 16:54079346-54079368 TACGTTTTCTGGGTCTGAACTGG + Intronic
1155410882 18:25543351-25543373 TACGTTTAATGCTTCTCACCTGG + Intergenic
1158543326 18:58375705-58375727 GAGGTCTTCTGGGTCTCTCCAGG + Intronic
926495224 2:13578029-13578051 GATGTTTTCTGGTTGTGACAAGG + Intergenic
930834727 2:55781202-55781224 AAAGTTTTCTGATTCTCTCCAGG - Intergenic
934307409 2:91838906-91838928 GACGGACTCAGGTTCTCACCAGG - Intergenic
934325848 2:92013807-92013829 GACGGACTCAGGTTCTCACCAGG + Intergenic
934464199 2:94244453-94244475 GACGGACTCAGGTTCTCACCAGG + Intergenic
937135451 2:119547746-119547768 GATGTTTTTTTCTTCTCACCAGG - Intronic
937502133 2:122490615-122490637 CGGGTTTTCTGGCTCTCACCGGG + Intergenic
940155656 2:150653575-150653597 GATGTTATCTGGTTCTCCCAAGG - Intergenic
944742403 2:202625241-202625263 GGCGTTTTCTGGTTCTTAAAAGG - Intergenic
947868647 2:233419628-233419650 AACATTCTGTGGTTCTCACCTGG + Intronic
1171351793 20:24508030-24508052 GAAGTGTTCTGGATCTCCCCAGG + Intronic
1171795722 20:29565614-29565636 GATGTTTTGTGGTTCTAACAAGG + Intergenic
1171852507 20:30318527-30318549 GATGTTTTGTGGTTCTAACGAGG - Intergenic
1173487105 20:43448990-43449012 GAAGTTTTCTGGCCCTCACTTGG - Intergenic
1173746089 20:45438072-45438094 TACCTTTTCTGGTTCCCAGCAGG - Intergenic
1176015496 20:62929218-62929240 GACGTTTTATTCTTCTCACCTGG + Intronic
1180278112 22:10664748-10664770 GACGGACTCAGGTTCTCACCAGG + Intergenic
1180585361 22:16883601-16883623 GACGGACTCAGGTTCTCACCAGG + Intergenic
1183186752 22:36295897-36295919 GAGGTTTTCTGCTTCTCAGAGGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
949943281 3:9171143-9171165 GACTTTTTCAGGTTCTCATGGGG - Intronic
953777236 3:45830730-45830752 GAAGGTCACTGGTTCTCACCAGG + Intronic
954101899 3:48380023-48380045 GACCTTTTCTGTTTCTGACCTGG - Intronic
957811815 3:85231735-85231757 GAAGTTTTGTTCTTCTCACCTGG + Intronic
963692121 3:148518282-148518304 GTCTTTTTCTGGTTCTCAAGGGG - Intergenic
967102939 3:186231162-186231184 TACGTTCTCTGTTTCTCTCCAGG + Intronic
967888179 3:194347101-194347123 GAGGTTTTCTGCTCCTCATCTGG + Intronic
984158798 4:176226224-176226246 GAGGTTTTTTTGTTCTCTCCAGG - Intronic
991176185 5:63689718-63689740 GACGTTTTCTCTTCCTCCCCTGG + Intergenic
997429236 5:133826039-133826061 GAAGTTGCCTGCTTCTCACCTGG - Intergenic
1000230505 5:159311186-159311208 TCCCTTTTCTGTTTCTCACCAGG + Intergenic
1009589398 6:65646596-65646618 GTCGTGTTCTGGTTCTCAGAAGG - Intronic
1010656529 6:78518186-78518208 GAAGTTTTCTGGTTCCAGCCTGG + Intergenic
1014755312 6:125296408-125296430 GAGGTTTCCTGGTTCTCATTAGG + Intronic
1014880449 6:126717474-126717496 GTCTTTTCCTGTTTCTCACCAGG - Intergenic
1020189481 7:5984472-5984494 GACGTTTTCTGGTTCTCACCTGG + Intronic
1020293437 7:6740183-6740205 GACGTTTTCTGGTTCTCACCTGG - Intergenic
1024833789 7:53492776-53492798 GAGGTTTTATGCCTCTCACCTGG - Intergenic
1026877322 7:73887079-73887101 GACATTTTCTGCTTCTCATGGGG + Intergenic
1031968373 7:128045155-128045177 GGCGTTTTCAGGTTCTTAACTGG - Intronic
1032473423 7:132194589-132194611 AAGGTTTTCTGGTCCCCACCTGG + Intronic
1040684030 8:49848703-49848725 GGCCTTTTGTGGTTCTCCCCAGG - Intergenic
1043007292 8:74835425-74835447 CACATTTTAGGGTTCTCACCAGG - Intronic
1049402491 8:142435784-142435806 GATGTTTTCTGTTGCTCATCAGG + Intergenic
1053694288 9:40621224-40621246 GACGGACTCAGGTTCTCACCAGG + Intergenic
1053941277 9:43251630-43251652 GACGGAGTCAGGTTCTCACCAGG + Intergenic
1054154845 9:61632930-61632952 GATGTTTTGTGGTTCTAACGAGG + Intergenic
1054270548 9:63018904-63018926 GACGGACTCAGGTTCTCACCAGG - Intergenic
1054305533 9:63420448-63420470 GACGGACTCAGGTTCTCACCAGG + Intergenic
1054404279 9:64744435-64744457 GACGGACTCAGGTTCTCACCAGG + Intergenic
1054437901 9:65229932-65229954 GACGGACTCAGGTTCTCACCAGG + Intergenic
1054492503 9:65792030-65792052 GACGGACTCAGGTTCTCACCAGG - Intergenic
1059691476 9:116688995-116689017 GATGTTTTTTGGTTGTCACAGGG + Intronic
1060749539 9:126159863-126159885 CACATGTTCTGGTACTCACCAGG + Intergenic
1190883983 X:54514573-54514595 TAGGTTTTCTGGTTCTTACTAGG - Intergenic
1192554983 X:72082149-72082171 GACCTATTCTTGTGCTCACCTGG - Intergenic
1193151876 X:78133972-78133994 GACATCTTCTGATTCTCAGCAGG - Intronic
1193598326 X:83476334-83476356 GTCTTGTTCTGGTTCTCAACAGG - Intergenic
1193840415 X:86402107-86402129 GTCTTTTTCTGGTTCTCAAAGGG - Intronic
1193899054 X:87152840-87152862 GTCGTTTTCTGGTTTTCAAGAGG + Intergenic
1195534459 X:105995544-105995566 GTCTTATTCTGGTTCTCAACTGG - Intergenic
1201797808 Y:17919777-17919799 GAAGATTTCTAGTTCTCACAGGG - Intergenic
1201803745 Y:17986180-17986202 GAAGATTTCTAGTTCTCACAGGG + Intergenic
1202359143 Y:24088519-24088541 GAAGATTTCTAGTTCTCACAGGG - Intergenic
1202511635 Y:25581595-25581617 GAAGATTTCTAGTTCTCACAGGG + Intergenic