ID: 1020192165

View in Genome Browser
Species Human (GRCh38)
Location 7:6008858-6008880
Sequence CGCCACTCCGGGGCCTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 129}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192152_1020192165 29 Left 1020192152 7:6008806-6008828 CCTCGGCCTCAAGGCGCACCCAA 0: 1
1: 0
2: 5
3: 6
4: 166
Right 1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 129
1020192156_1020192165 23 Left 1020192156 7:6008812-6008834 CCTCAAGGCGCACCCAAGGGGCA 0: 1
1: 0
2: 0
3: 7
4: 78
Right 1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 129
1020192158_1020192165 10 Left 1020192158 7:6008825-6008847 CCAAGGGGCACGAGATCGCTGCA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 129
1020192157_1020192165 11 Left 1020192157 7:6008824-6008846 CCCAAGGGGCACGAGATCGCTGC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1020192165 7:6008858-6008880 CGCCACTCCGGGGCCTCCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192165 Original CRISPR CGCCACTCCGGGGCCTCCAG GGG Intronic