ID: 1020192304

View in Genome Browser
Species Human (GRCh38)
Location 7:6009489-6009511
Sequence CCCGCGCTCCTACCTGCACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 4, 2: 1, 3: 8, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192304_1020192318 23 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192318 7:6009535-6009557 CGGCGACCGGCTGCTGGCCCGGG 0: 1
1: 0
2: 4
3: 18
4: 139
1020192304_1020192315 10 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192315 7:6009522-6009544 CAGTGCGCACGCGCGGCGACCGG 0: 1
1: 0
2: 5
3: 3
4: 51
1020192304_1020192316 17 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192304_1020192317 22 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192304_1020192310 3 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192310 7:6009515-6009537 CCCCGCCCAGTGCGCACGCGCGG 0: 1
1: 4
2: 3
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192304 Original CRISPR CCCGCGCTCCTACCTGCACG TGG (reversed) Exonic