ID: 1020192307

View in Genome Browser
Species Human (GRCh38)
Location 7:6009513-6009535
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 3, 2: 4, 3: 9, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192307_1020192321 13 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192321 7:6009549-6009571 TGGCCCGGGTCCCCCCAGGCCGG 0: 1
1: 0
2: 6
3: 30
4: 274
1020192307_1020192320 9 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192307_1020192316 -7 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192307_1020192317 -2 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192307_1020192318 -1 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192318 7:6009535-6009557 CGGCGACCGGCTGCTGGCCCGGG 0: 1
1: 0
2: 4
3: 18
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192307 Original CRISPR GCGCGTGCGCACTGGGCGGG GGG (reversed) Intronic