ID: 1020192311

View in Genome Browser
Species Human (GRCh38)
Location 7:6009516-6009538
Sequence GCCGCGCGTGCGCACTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 4, 2: 3, 3: 13, 4: 105}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192311_1020192318 -4 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192318 7:6009535-6009557 CGGCGACCGGCTGCTGGCCCGGG 0: 1
1: 0
2: 4
3: 18
4: 139
1020192311_1020192321 10 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192321 7:6009549-6009571 TGGCCCGGGTCCCCCCAGGCCGG 0: 1
1: 0
2: 6
3: 30
4: 274
1020192311_1020192317 -5 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192311_1020192320 6 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192311_1020192316 -10 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192311_1020192330 30 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192311 Original CRISPR GCCGCGCGTGCGCACTGGGC GGG (reversed) Intronic