ID: 1020192313

View in Genome Browser
Species Human (GRCh38)
Location 7:6009520-6009542
Sequence GGTCGCCGCGCGTGCGCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 1, 2: 4, 3: 0, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192313_1020192317 -9 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192313_1020192330 26 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192313_1020192320 2 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192313_1020192321 6 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192321 7:6009549-6009571 TGGCCCGGGTCCCCCCAGGCCGG 0: 1
1: 0
2: 6
3: 30
4: 274
1020192313_1020192318 -8 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192318 7:6009535-6009557 CGGCGACCGGCTGCTGGCCCGGG 0: 1
1: 0
2: 4
3: 18
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192313 Original CRISPR GGTCGCCGCGCGTGCGCACT GGG (reversed) Intronic