ID: 1020192315

View in Genome Browser
Species Human (GRCh38)
Location 7:6009522-6009544
Sequence CAGTGCGCACGCGCGGCGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 5, 3: 3, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192301_1020192315 21 Left 1020192301 7:6009478-6009500 CCGGGCGCTGGCCACGTGCAGGT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1020192315 7:6009522-6009544 CAGTGCGCACGCGCGGCGACCGG 0: 1
1: 0
2: 5
3: 3
4: 51
1020192298_1020192315 28 Left 1020192298 7:6009471-6009493 CCCAGCGCCGGGCGCTGGCCACG 0: 1
1: 0
2: 1
3: 21
4: 113
Right 1020192315 7:6009522-6009544 CAGTGCGCACGCGCGGCGACCGG 0: 1
1: 0
2: 5
3: 3
4: 51
1020192304_1020192315 10 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192315 7:6009522-6009544 CAGTGCGCACGCGCGGCGACCGG 0: 1
1: 0
2: 5
3: 3
4: 51
1020192299_1020192315 27 Left 1020192299 7:6009472-6009494 CCAGCGCCGGGCGCTGGCCACGT 0: 1
1: 0
2: 1
3: 15
4: 108
Right 1020192315 7:6009522-6009544 CAGTGCGCACGCGCGGCGACCGG 0: 1
1: 0
2: 5
3: 3
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192315 Original CRISPR CAGTGCGCACGCGCGGCGAC CGG Intronic