ID: 1020192316

View in Genome Browser
Species Human (GRCh38)
Location 7:6009529-6009551
Sequence CACGCGCGGCGACCGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 1, 2: 3, 3: 4, 4: 59}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192307_1020192316 -7 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192308_1020192316 -8 Left 1020192308 7:6009514-6009536 CCCCCGCCCAGTGCGCACGCGCG 0: 1
1: 4
2: 3
3: 12
4: 111
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192311_1020192316 -10 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192309_1020192316 -9 Left 1020192309 7:6009515-6009537 CCCCGCCCAGTGCGCACGCGCGG 0: 1
1: 5
2: 5
3: 15
4: 86
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192301_1020192316 28 Left 1020192301 7:6009478-6009500 CCGGGCGCTGGCCACGTGCAGGT 0: 1
1: 0
2: 1
3: 8
4: 130
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59
1020192304_1020192316 17 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192316 7:6009529-6009551 CACGCGCGGCGACCGGCTGCTGG 0: 1
1: 1
2: 3
3: 4
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192316 Original CRISPR CACGCGCGGCGACCGGCTGC TGG Intronic