ID: 1020192317

View in Genome Browser
Species Human (GRCh38)
Location 7:6009534-6009556
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 128}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192309_1020192317 -4 Left 1020192309 7:6009515-6009537 CCCCGCCCAGTGCGCACGCGCGG 0: 1
1: 5
2: 5
3: 15
4: 86
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192314_1020192317 -10 Left 1020192314 7:6009521-6009543 CCAGTGCGCACGCGCGGCGACCG 0: 1
1: 0
2: 4
3: 6
4: 67
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192304_1020192317 22 Left 1020192304 7:6009489-6009511 CCACGTGCAGGTAGGAGCGCGGG 0: 1
1: 4
2: 1
3: 8
4: 76
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192308_1020192317 -3 Left 1020192308 7:6009514-6009536 CCCCCGCCCAGTGCGCACGCGCG 0: 1
1: 4
2: 3
3: 12
4: 111
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192312_1020192317 -6 Left 1020192312 7:6009517-6009539 CCGCCCAGTGCGCACGCGCGGCG 0: 1
1: 4
2: 2
3: 7
4: 96
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192311_1020192317 -5 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192307_1020192317 -2 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128
1020192313_1020192317 -9 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192317 7:6009534-6009556 GCGGCGACCGGCTGCTGGCCCGG 0: 1
1: 0
2: 3
3: 14
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type