ID: 1020192320

View in Genome Browser
Species Human (GRCh38)
Location 7:6009545-6009567
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192307_1020192320 9 Left 1020192307 7:6009513-6009535 CCCCCCGCCCAGTGCGCACGCGC 0: 1
1: 3
2: 4
3: 9
4: 156
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192309_1020192320 7 Left 1020192309 7:6009515-6009537 CCCCGCCCAGTGCGCACGCGCGG 0: 1
1: 5
2: 5
3: 15
4: 86
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192308_1020192320 8 Left 1020192308 7:6009514-6009536 CCCCCGCCCAGTGCGCACGCGCG 0: 1
1: 4
2: 3
3: 12
4: 111
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192313_1020192320 2 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192312_1020192320 5 Left 1020192312 7:6009517-6009539 CCGCCCAGTGCGCACGCGCGGCG 0: 1
1: 4
2: 2
3: 7
4: 96
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192314_1020192320 1 Left 1020192314 7:6009521-6009543 CCAGTGCGCACGCGCGGCGACCG 0: 1
1: 0
2: 4
3: 6
4: 67
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287
1020192311_1020192320 6 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192320 7:6009545-6009567 CTGCTGGCCCGGGTCCCCCCAGG 0: 1
1: 1
2: 0
3: 32
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type