ID: 1020192330

View in Genome Browser
Species Human (GRCh38)
Location 7:6009569-6009591
Sequence CGGAGCGAGCGCGTCCCAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020192311_1020192330 30 Left 1020192311 7:6009516-6009538 CCCGCCCAGTGCGCACGCGCGGC 0: 1
1: 4
2: 3
3: 13
4: 105
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192313_1020192330 26 Left 1020192313 7:6009520-6009542 CCCAGTGCGCACGCGCGGCGACC 0: 1
1: 1
2: 4
3: 0
4: 35
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192323_1020192330 -7 Left 1020192323 7:6009553-6009575 CCGGGTCCCCCCAGGCCGGAGCG 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192314_1020192330 25 Left 1020192314 7:6009521-6009543 CCAGTGCGCACGCGCGGCGACCG 0: 1
1: 0
2: 4
3: 6
4: 67
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192319_1020192330 5 Left 1020192319 7:6009541-6009563 CCGGCTGCTGGCCCGGGTCCCCC 0: 1
1: 1
2: 6
3: 43
4: 375
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192312_1020192330 29 Left 1020192312 7:6009517-6009539 CCGCCCAGTGCGCACGCGCGGCG 0: 1
1: 4
2: 2
3: 7
4: 96
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1020192322_1020192330 -6 Left 1020192322 7:6009552-6009574 CCCGGGTCCCCCCAGGCCGGAGC 0: 1
1: 0
2: 1
3: 29
4: 332
Right 1020192330 7:6009569-6009591 CGGAGCGAGCGCGTCCCAACCGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020192330 Original CRISPR CGGAGCGAGCGCGTCCCAAC CGG Intronic