ID: 1020193763

View in Genome Browser
Species Human (GRCh38)
Location 7:6020978-6021000
Sequence CTGGACAAGAACGCTTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 3, 2: 7, 3: 17, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020193763 Original CRISPR CTGGACAAGAACGCTTTTTC TGG Intronic
909770134 1:79411884-79411906 CTTGACAAGTACTCATTTTCTGG - Intergenic
911870632 1:103093647-103093669 TTGGACAAGAACCCTTTTTCTGG + Intronic
913585523 1:120271830-120271852 CTGGACTAGAACGTTATTCCAGG + Intergenic
913622660 1:120626537-120626559 CTGGACTAGAACGTTATTCCAGG - Intergenic
914567529 1:148883689-148883711 CTGGACTAGAACGTTATTCCAGG + Intronic
914605293 1:149246556-149246578 CTGGACTAGAACGTTATTCCAGG - Intergenic
915851981 1:159333989-159334011 CTGGATGAGAACCCTTTTTCTGG - Intergenic
917970179 1:180201229-180201251 CTGGCCAAGAATCCTTTCTCTGG - Exonic
919579235 1:199350508-199350530 CAGGACAAGAGCCCTTTTTATGG + Intergenic
919771147 1:201159435-201159457 CTGGACAAGCACGCTGTTTTTGG + Intronic
1064278811 10:13932115-13932137 CTGGACAAAAATGTTTTCTCAGG - Intronic
1064486824 10:15801389-15801411 CTGGAAGAGAATGCTTTCTCTGG + Intronic
1064739648 10:18419601-18419623 CTGGACAAGACCCCTTTTCCAGG - Intronic
1070096974 10:73346914-73346936 CTGGATAAGAACAGTTTTTGTGG + Intronic
1071014126 10:80974674-80974696 CTGGACAAGAACACTTTTTATGG - Intergenic
1073927861 10:108537875-108537897 CTGAACAAGAATGGTTTATCAGG + Intergenic
1076718591 10:132382029-132382051 CTGGACAAGAACCTCTTTTCTGG + Intergenic
1078370928 11:10744479-10744501 CTTGACAAGAACACTCTTTAAGG - Intergenic
1080933568 11:36838591-36838613 CAGGACATGAACTCTTGTTCCGG + Intergenic
1082270873 11:50168366-50168388 GTTGACAAGAGAGCTTTTTCTGG - Intergenic
1084991463 11:72929403-72929425 CTGCACATGAACTCATTTTCTGG + Intronic
1086753936 11:90534425-90534447 GTGAACAAGAAAGGTTTTTCAGG + Intergenic
1087455151 11:98375686-98375708 TTTAACAAGAACGTTTTTTCAGG - Intergenic
1090459047 11:126873794-126873816 TTGGACAAAAATGCTTTTTCAGG + Intronic
1092231335 12:6777330-6777352 CTGGACAAGAACGCTTTGTGTGG + Exonic
1093530022 12:20149633-20149655 CTTGATGAGAACCCTTTTTCTGG - Intergenic
1094126007 12:27022849-27022871 CCGGACAAGAACGATCTTCCCGG - Intronic
1094280156 12:28728191-28728213 CTGATAAAGAATGCTTTTTCTGG + Intergenic
1095814732 12:46408706-46408728 CTGGGAAAGGAGGCTTTTTCAGG + Intergenic
1096037525 12:48485752-48485774 AAGGAAAAGAACACTTTTTCGGG + Intronic
1099418114 12:82419416-82419438 CTGGACAAGAACCCTTTTTCTGG + Intronic
1101472018 12:105006554-105006576 TTGGACAAGACCCCTTTGTCTGG - Intronic
1102333867 12:112060103-112060125 CTGGCCAAGACAGGTTTTTCTGG + Intronic
1102727186 12:115075939-115075961 ATGGAGAAGAACGGTTTTTCAGG + Intergenic
1103570291 12:121840136-121840158 CTGGAAATGACCTCTTTTTCTGG + Intronic
1108401764 13:50052108-50052130 ATGAACGAGAATGCTTTTTCTGG + Intergenic
1116520192 14:45837088-45837110 CGGGACAAGAACTCTTTTTCTGG - Intergenic
1117635010 14:57733479-57733501 CTGAAAAAAAAAGCTTTTTCTGG - Intronic
1121478851 14:94243209-94243231 TTTTAAAAGAACGCTTTTTCTGG + Intronic
1127462796 15:59214979-59215001 CTGTCCAAGTAAGCTTTTTCAGG + Intronic
1135532275 16:23265007-23265029 CTGGAGATGAAAGATTTTTCTGG - Intergenic
1136078119 16:27830831-27830853 ATGAACAAGTAGGCTTTTTCTGG + Intronic
1137588466 16:49679101-49679123 CTGAACAAAAACAATTTTTCAGG - Intronic
1145128487 17:20320940-20320962 CAGGCCAAGAAGTCTTTTTCTGG + Intergenic
1149525595 17:57353132-57353154 CTGGAGGAGAGCGCATTTTCGGG - Intronic
1153804523 18:8700864-8700886 CTGGACATGAAGCCTTTTTCAGG + Intergenic
1164446906 19:28325561-28325583 CTTGGAAAAAACGCTTTTTCAGG - Intergenic
1164794587 19:31015570-31015592 CAGGACAGGAACACTTTTCCTGG + Intergenic
926701765 2:15808641-15808663 CTAGCCAAGAAGGATTTTTCTGG + Intergenic
928220086 2:29396210-29396232 CTGGATAATAACGCTGTTGCAGG + Intronic
930266597 2:49207486-49207508 GACAACAAGAACGCTTTTTCTGG + Intergenic
930388850 2:50734653-50734675 CTGTAGAAAAATGCTTTTTCTGG + Intronic
931596468 2:63950555-63950577 CTGGATGAGAACCCTTTTTCTGG - Intronic
932418966 2:71590267-71590289 ATGGACAAGGACTCTTTTTCTGG + Exonic
936979140 2:118247900-118247922 CTGGACAAGTAGGATTTCTCTGG - Intergenic
937162227 2:119775328-119775350 CTGGACAATAACTCTTTTTCTGG + Intronic
947890059 2:233609647-233609669 CTCGACAAGAACACTTCTTCTGG - Intergenic
947895795 2:233670885-233670907 CTCGGCAAGAACACTTTTTCTGG - Intronic
948452275 2:238083327-238083349 GTGGACAAGAACGGAATTTCAGG + Exonic
1168872925 20:1146389-1146411 CTGGACAAAAATGATTTGTCTGG + Intronic
1170182091 20:13543300-13543322 GTGGCCAAGAAATCTTTTTCTGG - Intronic
1171035478 20:21709554-21709576 CTGGGCATGAACCCTTCTTCTGG + Intronic
1174422638 20:50409793-50409815 CTGCACAGGGATGCTTTTTCGGG + Intergenic
1178063986 21:28883563-28883585 CAGGACAAAAATTCTTTTTCTGG + Intronic
1181435676 22:22909247-22909269 CTGGCCAAGAACCAATTTTCAGG - Intergenic
1184925525 22:47633903-47633925 CTGGGGAAGCAAGCTTTTTCGGG + Intergenic
951689394 3:25380028-25380050 CTGGATAAGAACTCGTTTTGAGG + Intronic
951875098 3:27415300-27415322 CTGGATGAGAGCCCTTTTTCTGG - Intronic
954997669 3:54896407-54896429 CTAAACAAGAAAGCTTTGTCTGG - Intronic
955418887 3:58717713-58717735 CAGGAAAACAATGCTTTTTCTGG + Intronic
956437752 3:69250784-69250806 TTGGTAAAGAATGCTTTTTCAGG + Intronic
960292393 3:115901405-115901427 CTGGACTTGAACACTATTTCGGG - Intronic
969572622 4:8018750-8018772 CTGGACAAGAACGTTTAATATGG + Intronic
974874951 4:67692541-67692563 CTGGACAAGAACCCTTTTTCTGG + Intronic
975925507 4:79446183-79446205 AGGGACAAGAACGATTTATCAGG + Intergenic
976313843 4:83638437-83638459 CTGGACAAGAACCCTGTTTAGGG + Intergenic
977900914 4:102421413-102421435 TTGGACAAGAATCTTTTTTCAGG + Intronic
978489446 4:109296584-109296606 CTGGACAAGAATGATTTTGAAGG - Intronic
978605432 4:110474624-110474646 GTTGACAAGACAGCTTTTTCTGG - Intronic
979359373 4:119743678-119743700 CTTGACAAGAATTCTTTTCCAGG - Intergenic
979863714 4:125726244-125726266 CTGGACAAGAACCATTTTTCTGG - Intergenic
981167327 4:141576746-141576768 TTTGACAAGAACGCTCTTGCTGG - Intergenic
981701055 4:147607978-147608000 ATGGGAAAGAACGCATTTTCAGG + Intergenic
983248729 4:165320353-165320375 CTAGACAAGAAATCTTTTCCCGG + Intronic
983865640 4:172762190-172762212 CTGCTCAAGTACGCTTTTGCAGG - Intronic
987299132 5:16581182-16581204 GTGGTCAAGAACCCTTTCTCGGG + Intronic
992471654 5:77062511-77062533 GGGGATAAGAACTCTTTTTCAGG + Intronic
992627751 5:78649538-78649560 CTGGACAAGAATGCCTTTTCAGG - Intronic
998228439 5:140344565-140344587 CTGGGCAAGGACTATTTTTCAGG - Intronic
1003033094 6:2619738-2619760 CTGGAAAAGAAGGCATTTTTTGG - Intergenic
1006804415 6:36778902-36778924 CTGGACAAGAAAGATTTCTTTGG - Exonic
1010639681 6:78309086-78309108 CTAGACAAGAGCAATTTTTCTGG + Intergenic
1013809027 6:114023532-114023554 CTGGACAGGTAGGCTTTTTATGG + Intergenic
1016268956 6:142266054-142266076 CTGGATAAGAACAGTGTTTCAGG - Intergenic
1020193763 7:6020978-6021000 CTGGACAAGAACGCTTTTTCTGG + Intronic
1023686952 7:42745854-42745876 CTGGGCTAGAAGGCATTTTCAGG + Intergenic
1028861955 7:95662456-95662478 CTGGACAATAACAACTTTTCAGG + Intergenic
1030002808 7:105083492-105083514 CTGGAGGAGAACCCTTTTTCTGG - Intronic
1030131388 7:106204660-106204682 CTGGACAAGAACCCTTTTTCTGG - Intergenic
1030617432 7:111752907-111752929 CAGGACAAAAACACTTTTTTTGG + Intronic
1031380030 7:121074292-121074314 CTGGACAAGAGCCCCTTTTCTGG - Intronic
1039011660 8:33100288-33100310 CTGGGCCAGAGCGCTTTTGCAGG + Intergenic
1041601962 8:59729619-59729641 CTGAACAACAACTCTTTTTCTGG + Intergenic
1045680532 8:104654945-104654967 ATGGACAGGAACTCTGTTTCGGG - Intronic
1047376918 8:124308094-124308116 GACGACAAGAACCCTTTTTCTGG + Intergenic
1051149704 9:14066985-14067007 CTGCCCAAGAAAGCTTGTTCAGG + Intergenic
1056228324 9:84518902-84518924 CTGGACAATACTACTTTTTCTGG + Intergenic
1057240643 9:93405509-93405531 CTGGATAGGATCCCTTTTTCTGG - Intergenic
1059888631 9:118775758-118775780 CTTGACAAGAATGGTTTTGCTGG + Intergenic
1060301355 9:122376211-122376233 CTGGACAAAAAGGCTTTATCAGG - Intronic
1203625461 Un_KI270750v1:14842-14864 CTGAACACGAAGTCTTTTTCTGG - Intergenic
1188025325 X:25202310-25202332 CTGGACAAGGACACTTTTGCTGG + Intergenic
1192005950 X:67212579-67212601 CTGGACAAGAACACCATTACAGG - Intergenic
1192830674 X:74747935-74747957 CAGGACAAGAACACTATGTCAGG + Intronic
1194299477 X:92167975-92167997 GTGCACAAGAATCCTTTTTCTGG + Intronic
1200617124 Y:5393104-5393126 GTGCACAAGAATCCTTTTTCTGG + Intronic