ID: 1020198331

View in Genome Browser
Species Human (GRCh38)
Location 7:6059423-6059445
Sequence CGAATGTCAGTGTAAGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020198325_1020198331 24 Left 1020198325 7:6059376-6059398 CCAGCTACCCCAGAAGGGTCTTA 0: 1
1: 0
2: 1
3: 4
4: 101
Right 1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1020198326_1020198331 17 Left 1020198326 7:6059383-6059405 CCCCAGAAGGGTCTTAGCGCTCA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1020198327_1020198331 16 Left 1020198327 7:6059384-6059406 CCCAGAAGGGTCTTAGCGCTCAC 0: 1
1: 0
2: 0
3: 4
4: 45
Right 1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1020198324_1020198331 25 Left 1020198324 7:6059375-6059397 CCCAGCTACCCCAGAAGGGTCTT 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1020198328_1020198331 15 Left 1020198328 7:6059385-6059407 CCAGAAGGGTCTTAGCGCTCACG 0: 1
1: 0
2: 0
3: 3
4: 23
Right 1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020198331 Original CRISPR CGAATGTCAGTGTAAGAATC AGG Intergenic
908174300 1:61539006-61539028 AGAATGAAGGTGTAAGAATCTGG - Intergenic
916204207 1:162299835-162299857 CTAATGTCACTGTAAGAGCCTGG + Intronic
922183034 1:223251001-223251023 AGGATTTCAGTGTAAGAATCTGG - Intronic
1063267476 10:4470210-4470232 CGAATTTAAGTTTTAGAATCAGG - Intergenic
1064477517 10:15706973-15706995 GGAGTGTCAGTGTTAGAGTCTGG - Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1067005436 10:42656479-42656501 CAAATGTGAGTGTATGTATCAGG - Intergenic
1068503968 10:57875620-57875642 GGCATGTCAGTGGAAGAAACAGG - Intergenic
1074221780 10:111445048-111445070 AGAATGTAAGAGGAAGAATCAGG - Intergenic
1080261681 11:30356136-30356158 TGCATGTCAGAGTAAGCATCAGG + Intergenic
1081431632 11:42982882-42982904 CAAATGGCAGAGGAAGAATCTGG + Intergenic
1083733118 11:64663991-64664013 CTACTTTCTGTGTAAGAATCTGG - Intronic
1096913242 12:55005106-55005128 GGGATGTCATTGTAAGAACCTGG + Intergenic
1098652387 12:72989709-72989731 CGATTGTCACTGTGAGAAGCTGG + Intergenic
1108925984 13:55745593-55745615 AGAATGTCTGTGGAAGCATCAGG - Intergenic
1110083629 13:71348177-71348199 GGAATGAGAGTGAAAGAATCAGG - Intergenic
1110667534 13:78135835-78135857 AGAATGTAAGTGTATGAATTAGG + Intergenic
1117467081 14:56004397-56004419 CCAATGTCAGTGGAGGAAACTGG + Intergenic
1120026553 14:79591848-79591870 TGAATTTCAGTGTAAGAAATCGG - Intronic
1121063812 14:90941617-90941639 TGAAAGTCTGTGTAAGAAACAGG - Intronic
1136637075 16:31531140-31531162 GCAATGTCAGTGTGAGAGTCAGG - Intergenic
1137556181 16:49471883-49471905 TGAATGTCAGTCTAAGGAGCAGG + Intergenic
1138656711 16:58495713-58495735 CGAGGATCAGTGTGAGAATCTGG + Intronic
1144287737 17:13794723-13794745 CGAATGTCCCTGTTAGAATCAGG + Intergenic
1144398071 17:14865189-14865211 TGAATGTCAGAGTAAGAAAGTGG - Intergenic
1151148611 17:72064603-72064625 CCAATATCAGTGTATGAATTAGG - Intergenic
1153991853 18:10407513-10407535 AGAATGAAAGTTTAAGAATCAGG + Intergenic
1162219815 19:9166893-9166915 CGTATGTCGGTGTAATTATCAGG + Intergenic
1163132599 19:15284929-15284951 CGCCTGTCAGTGTAAGAGTTGGG - Intronic
925162920 2:1698710-1698732 TGAATGTAAGTGGAAGAGTCTGG - Intronic
925228814 2:2212000-2212022 CAAATGCCAGTGGAAGAGTCAGG + Intronic
926473945 2:13298670-13298692 CCAAACTCTGTGTAAGAATCAGG + Intergenic
927305745 2:21570589-21570611 CCAATTTCACTGTGAGAATCTGG + Intergenic
929376527 2:41293179-41293201 AGAATGTAAATTTAAGAATCTGG - Intergenic
933390363 2:81659138-81659160 CAAATCTCAGTGTTAAAATCAGG + Intergenic
943393066 2:187295024-187295046 CAAATGTCAGGGTAGGAATGAGG - Intergenic
944896013 2:204165632-204165654 GGAATGTCATTCTTAGAATCAGG + Intergenic
1169280266 20:4261300-4261322 TGAAGGTCTGTGTAAGAATCAGG + Intergenic
1169747161 20:8954051-8954073 CGAATTTCAATATAAGAATTTGG + Intronic
1169965244 20:11210299-11210321 TGAAGATGAGTGTAAGAATCAGG - Intergenic
1170003618 20:11642309-11642331 CGAATGTCATTTTAAGTCTCCGG - Intergenic
1171070029 20:22059452-22059474 CAAATGTCAGTGGAAGCTTCAGG - Intergenic
953449086 3:42991427-42991449 TGAATGTCAATGTAAGCATGTGG - Intronic
965840785 3:172903281-172903303 CAAATTTCAGTGTAATATTCTGG - Intronic
966979176 3:185114924-185114946 TGAAAGTTAGAGTAAGAATCTGG - Intronic
976489927 4:85658496-85658518 AGAATTTCAGTATAAGAAGCTGG - Intronic
976783105 4:88783767-88783789 CTAATGTCATTGTAAGAAGAGGG + Intronic
979373939 4:119922027-119922049 GAAATGTCAGTGCAAGACTCTGG - Intergenic
979573863 4:122263194-122263216 CGAATGTCAATGTAGGCATTTGG + Intronic
981878599 4:149579530-149579552 CTAATGCCAGTGTTAGACTCTGG + Intergenic
984394211 4:179173363-179173385 TGAATGTCAGTGGCAAAATCAGG + Intergenic
987274204 5:16344830-16344852 CTTATGTTAGTGTAGGAATCGGG - Intergenic
995678820 5:114695030-114695052 CAGTTGTCAGTGTAGGAATCTGG - Intergenic
999085920 5:148889477-148889499 CAAATGCCATTGTAAGAATCAGG - Intergenic
1000286621 5:159832410-159832432 AGAATGACAGTGGAAGAAGCAGG + Intergenic
1002602569 5:180362338-180362360 GGAATTTCAGTGTTAGAACCAGG - Intergenic
1014077505 6:117252808-117252830 CAAATTTGAGTGTAAGAAGCAGG + Intergenic
1020198331 7:6059423-6059445 CGAATGTCAGTGTAAGAATCAGG + Intergenic
1023412295 7:39900233-39900255 GGATTGTCTGTGGAAGAATCAGG - Intergenic
1023825123 7:44003816-44003838 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1026088671 7:67282598-67282620 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1026725577 7:72867752-72867774 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026747664 7:73025616-73025638 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026751314 7:73053755-73053777 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026754963 7:73081869-73081891 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1026758615 7:73109903-73109925 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027033871 7:74910910-74910932 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027088790 7:75283582-75283604 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027092433 7:75311510-75311532 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027096076 7:75339477-75339499 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027118268 7:75497901-75497923 CAGATGTCAGTGTGAGAAGCAGG - Intergenic
1027273534 7:76537566-76537588 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027323263 7:77028215-77028237 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1027326982 7:77056623-77056645 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1029719225 7:102352139-102352161 CAGATGTCAGTGTGAGAAGCAGG + Intergenic
1029753390 7:102557127-102557149 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1029771339 7:102656211-102656233 CAGATGTCAGTGTGAGAAGCAGG - Intronic
1031395086 7:121263926-121263948 AGAATGTCAATGTATGAATTTGG - Intronic
1032646187 7:133826880-133826902 AGAATGTTAATGTTAGAATCCGG - Intronic
1041551200 8:59103241-59103263 TGAAAGTCAGGGAAAGAATCAGG + Intronic
1041942676 8:63405928-63405950 CCAATGACAGTGTAAAAAACTGG - Intergenic
1042037167 8:64546817-64546839 CAAATTTCAGAGTAAGAATGAGG + Intergenic
1043485555 8:80695505-80695527 AGCAAGTCATTGTAAGAATCAGG - Intronic
1043885766 8:85598271-85598293 CAAATATCAGTGAAAGCATCTGG - Intergenic
1044090967 8:88000908-88000930 CTAATGTCAGTGTGTGAATAAGG + Intergenic
1044467439 8:92524423-92524445 TGAAAGTCTGTGTAAGAAGCAGG + Intergenic
1058254027 9:102738318-102738340 AGGATGACAGAGTAAGAATCTGG - Intergenic
1186088480 X:6017577-6017599 GGAATGTCTGTGTAATAATTTGG - Intronic
1189917010 X:45865271-45865293 TGAATGTCAGAGGAAGAAGCAGG - Intergenic
1194693723 X:97018982-97019004 AGAAGCTCAGTGAAAGAATCCGG - Intronic
1196933452 X:120705039-120705061 CTAATGTGAGTTTAAGAACCAGG + Intergenic
1198285143 X:135182274-135182296 CAAATGTACGTGAAAGAATCTGG + Intergenic
1200934794 Y:8728990-8729012 TGAATGTCTGTGTATGTATCGGG - Intergenic