ID: 1020201526

View in Genome Browser
Species Human (GRCh38)
Location 7:6083808-6083830
Sequence CTGAATATGCAGATTGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020201526_1020201530 7 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201530 7:6083838-6083860 CGGGGAGAAGTTAGAAACCAAGG No data
1020201526_1020201531 8 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201531 7:6083839-6083861 GGGGAGAAGTTAGAAACCAAGGG No data
1020201526_1020201533 20 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201533 7:6083851-6083873 GAAACCAAGGGGACATATTCTGG No data
1020201526_1020201535 22 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201535 7:6083853-6083875 AACCAAGGGGACATATTCTGGGG No data
1020201526_1020201532 9 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201532 7:6083840-6083862 GGGAGAAGTTAGAAACCAAGGGG No data
1020201526_1020201534 21 Left 1020201526 7:6083808-6083830 CCTTACTCAATCTGCATATTCAG No data
Right 1020201534 7:6083852-6083874 AAACCAAGGGGACATATTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020201526 Original CRISPR CTGAATATGCAGATTGAGTA AGG (reversed) Intergenic
No off target data available for this crispr