ID: 1020202630

View in Genome Browser
Species Human (GRCh38)
Location 7:6092287-6092309
Sequence CTACTCAGGAGGTCTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020202630_1020202635 -10 Left 1020202630 7:6092287-6092309 CCTGCCTCAGACCTCCTGAGTAG No data
Right 1020202635 7:6092300-6092322 TCCTGAGTAGCTGGGATTATAGG 0: 4909
1: 66666
2: 155807
3: 234511
4: 197419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020202630 Original CRISPR CTACTCAGGAGGTCTGAGGC AGG (reversed) Intergenic
No off target data available for this crispr