ID: 1020204551

View in Genome Browser
Species Human (GRCh38)
Location 7:6104931-6104953
Sequence ACAATGACGTGCCTCCATCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 77}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204551_1020204555 -9 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204555 7:6104945-6104967 CGTCATTGTCCCCCGCCGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1020204551_1020204567 18 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204551_1020204570 28 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204551_1020204556 -5 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204556 7:6104949-6104971 ATTGTCCCCCGCCGGGCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 37
1020204551_1020204568 21 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204551_1020204564 9 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204564 7:6104963-6104985 GGCGGCTGGGCTGTGTGCGGCGG 0: 1
1: 0
2: 3
3: 56
4: 625
1020204551_1020204569 27 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204551_1020204572 30 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204551_1020204563 6 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204563 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 1
2: 1
3: 27
4: 341
1020204551_1020204566 15 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204566 7:6104969-6104991 TGGGCTGTGTGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 43
4: 430
1020204551_1020204557 -4 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204557 7:6104950-6104972 TTGTCCCCCGCCGGGCGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1020204551_1020204565 12 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204565 7:6104966-6104988 GGCTGGGCTGTGTGCGGCGGCGG 0: 1
1: 0
2: 4
3: 49
4: 494
1020204551_1020204571 29 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204551 Original CRISPR ACAATGACGTGCCTCCATCC GGG (reversed) Exonic
904444495 1:30557329-30557351 TCAATGAGGTGTCTCCATTCTGG - Intergenic
905840416 1:41172048-41172070 ACAGGCATGTGCCTCCATCCTGG - Intronic
908704867 1:66941826-66941848 ACAAGCATGTGCCACCATCCTGG - Intronic
915640987 1:157226033-157226055 ACAATGCACTGCCTCAATCCTGG - Intergenic
919420641 1:197365790-197365812 ACAAGGAGGTGCCTCCGTCCTGG - Intronic
919844396 1:201632252-201632274 ATGATGACTTGCCTCCAACCTGG + Intronic
1063467232 10:6254957-6254979 ACAGGCACGTGCCACCATCCTGG + Intergenic
1066696981 10:38087727-38087749 ACAAGCACGTGCCACCATTCCGG - Intergenic
1066995543 10:42559764-42559786 ACAAGCACGTGCCACCATCCCGG + Intergenic
1069556440 10:69401551-69401573 ACACTGCCGGGCCTCCCTCCCGG + Exonic
1070107874 10:73453166-73453188 ACTATGAAGTGCCTCCAGCAAGG - Intronic
1071366505 10:84905876-84905898 ACAATGAAGCTCTTCCATCCAGG + Intergenic
1072151166 10:92685511-92685533 AAAATGATGTGCTGCCATCCAGG - Intergenic
1074422676 10:113323217-113323239 ACAATGCCCTTCCTCCATCTAGG + Intergenic
1076080708 10:127578271-127578293 ACACTGACATGCATTCATCCAGG + Intergenic
1078004634 11:7523265-7523287 ACAAAGACAAGACTCCATCCTGG - Intronic
1081279424 11:41189890-41189912 ACACTGACGTGCCTTTATTCAGG + Intronic
1095796716 12:46226983-46227005 ACAATGACGTGCCTTGATGTGGG - Intronic
1098698614 12:73592892-73592914 ACAATGTCCTGCTTTCATCCTGG + Intergenic
1100302072 12:93316846-93316868 ACAATCACATGCCACCATGCTGG + Intergenic
1104655115 12:130568529-130568551 ACAATGACGTGCTCCCCTCTGGG + Intronic
1107412708 13:40172498-40172520 ACTATGACCGCCCTCCATCCAGG - Intergenic
1107784005 13:43936046-43936068 AGAATGTCTTTCCTCCATCCAGG - Intergenic
1108447346 13:50522864-50522886 ACAATGACGTGCTGACATCATGG - Intronic
1109720810 13:66273930-66273952 TCAATTATGTGCCTCCATACTGG - Intergenic
1114690939 14:24580583-24580605 ACAAGTATGTGCCACCATCCTGG - Intergenic
1116070456 14:40038066-40038088 AAAATGAGGTGCCTCCATTAAGG - Intergenic
1132117034 15:99145168-99145190 ACAAAGACGTGGGTCCAGCCAGG - Intronic
1136293989 16:29291461-29291483 ACACTGACGTGCCCCCTCCCAGG - Intergenic
1137047393 16:35681047-35681069 ACAATAAAGTGTTTCCATCCTGG - Intergenic
1137863534 16:51870580-51870602 ACAGTGACATGCCTGCATCTAGG + Intergenic
1138617498 16:58181825-58181847 ACAATGACGTGCCTTCGTATGGG - Intronic
1139213044 16:65099797-65099819 GCAATGACTTGCCTCCAAGCAGG + Intronic
1146584375 17:34069591-34069613 ACAAGGGAGTCCCTCCATCCAGG + Intronic
1152660584 17:81540138-81540160 ACAACTAGGTGCCTCCAGCCGGG - Exonic
1155948622 18:31884136-31884158 ACAGTGAAGTGGCTCCATCTCGG - Intronic
1156738881 18:40299738-40299760 CCAATGACTTTGCTCCATCCAGG + Intergenic
1157200152 18:45653177-45653199 ACAAGGACAGGCCTCCATGCAGG + Intronic
1157424829 18:47576029-47576051 ATACTGACCTGCCTCCCTCCCGG - Intergenic
1167205420 19:48098158-48098180 ACAATGACCTGCAACCTTCCTGG - Exonic
928315516 2:30241599-30241621 ACAAACACGTGCCACCATGCCGG + Intronic
930051576 2:47220087-47220109 AGAATGCCTTTCCTCCATCCTGG - Intergenic
936645263 2:114361817-114361839 ACAATGACTTGCCTTCATTTAGG - Intergenic
937637057 2:124167950-124167972 ATAAAAACGTGCCTCCTTCCTGG - Intronic
938480970 2:131661215-131661237 AGGATGACCAGCCTCCATCCGGG + Intergenic
947977934 2:234383985-234384007 ACACTGACTTGCCTCTATCAGGG - Intergenic
1185232264 22:49689994-49690016 ACAATACCGTGCCCCCAACCAGG + Intergenic
949340624 3:3026709-3026731 ACAATGACGTGCCTTCTACAAGG - Intronic
950569548 3:13791688-13791710 AGGATAAAGTGCCTCCATCCAGG - Intergenic
956882921 3:73529357-73529379 ACAAACACCTGCCTCTATCCAGG + Intronic
960813156 3:121644731-121644753 AGAAGCATGTGCCTCCATCCAGG + Intronic
962780311 3:138708576-138708598 AAAAAGAGTTGCCTCCATCCAGG - Intronic
969992391 4:11277964-11277986 ACCATAAAGTGCCTGCATCCAGG + Intergenic
969992459 4:11278438-11278460 ACCATAAAGTGCCTGCATCCAGG + Intergenic
972431238 4:38984221-38984243 ACAATGTGGTGCCTGCGTCCTGG + Intronic
972661595 4:41121802-41121824 ACAAAGACGTGGCTGCATCCGGG - Intronic
983074163 4:163304643-163304665 ACAATGAAGTGCCTGCAGGCAGG - Intergenic
984728863 4:183046885-183046907 ATAATGAAATTCCTCCATCCTGG + Intergenic
990867825 5:60399566-60399588 ACAATGATATACATCCATCCTGG + Intronic
992178782 5:74176395-74176417 ACAGTGACGTGCCTACCTTCAGG + Intergenic
992752542 5:79874582-79874604 TCAATGAAGTTCCTCCATCTTGG - Intergenic
993857365 5:93093125-93093147 ACAATGTCGTGGCCACATCCTGG + Intergenic
1000110715 5:158105738-158105760 ACGATGACATGGCTCCATCAGGG + Intergenic
1005479818 6:26244919-26244941 AAAAAGTAGTGCCTCCATCCAGG - Intergenic
1005705419 6:28446991-28447013 AAAGCGACGCGCCTCCATCCCGG - Intergenic
1008690198 6:53970254-53970276 ACAATGACATGCCTTCATTGAGG + Intronic
1015384093 6:132602345-132602367 ACAATTAGATGGCTCCATCCAGG + Intergenic
1020204551 7:6104931-6104953 ACAATGACGTGCCTCCATCCGGG - Exonic
1024698739 7:51883979-51884001 ACAGGGACGTGCCACCATGCTGG - Intergenic
1026570052 7:71521450-71521472 ACAAAGACGTGTCTCCAGGCAGG - Intronic
1035627526 8:1082609-1082631 TCAATCATCTGCCTCCATCCAGG + Intergenic
1049635759 8:143688180-143688202 AAAATGACATAACTCCATCCTGG - Intronic
1049798588 8:144507493-144507515 ACAGTGAACTGCCTCCTTCCTGG + Intergenic
1050303789 9:4286101-4286123 ACCCTGACATGCCTCCAGCCTGG + Exonic
1056899617 9:90585359-90585381 ATCATGACCTGCCTCCTTCCTGG - Intergenic
1057409492 9:94805015-94805037 TCACTGACCTGCCACCATCCTGG - Intronic
1058102399 9:100931833-100931855 ATAACCACCTGCCTCCATCCAGG + Intergenic
1059156314 9:111991952-111991974 ACAAGGGCGTGCCACCAGCCTGG + Intergenic
1061710073 9:132481278-132481300 ACAGTGAGGGGCCACCATCCAGG - Intronic
1194109373 X:89813732-89813754 AAAATGAAGTGCCTTCATTCTGG - Intergenic
1200462036 Y:3468474-3468496 AAAATGAAGTGCCTTCATTCTGG - Intergenic