ID: 1020204552

View in Genome Browser
Species Human (GRCh38)
Location 7:6104932-6104954
Sequence GACAATGACGTGCCTCCATC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204552_1020204571 28 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377
1020204552_1020204557 -5 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204557 7:6104950-6104972 TTGTCCCCCGCCGGGCGGCTGGG 0: 1
1: 0
2: 0
3: 3
4: 68
1020204552_1020204566 14 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204566 7:6104969-6104991 TGGGCTGTGTGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 43
4: 430
1020204552_1020204555 -10 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204555 7:6104945-6104967 CGTCATTGTCCCCCGCCGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 25
1020204552_1020204570 27 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204552_1020204564 8 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204564 7:6104963-6104985 GGCGGCTGGGCTGTGTGCGGCGG 0: 1
1: 0
2: 3
3: 56
4: 625
1020204552_1020204569 26 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204552_1020204568 20 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204552_1020204567 17 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204552_1020204572 29 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204552_1020204565 11 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204565 7:6104966-6104988 GGCTGGGCTGTGTGCGGCGGCGG 0: 1
1: 0
2: 4
3: 49
4: 494
1020204552_1020204556 -6 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204556 7:6104949-6104971 ATTGTCCCCCGCCGGGCGGCTGG 0: 1
1: 0
2: 0
3: 5
4: 37
1020204552_1020204563 5 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204563 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 1
2: 1
3: 27
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204552 Original CRISPR GACAATGACGTGCCTCCATC CGG (reversed) Exonic
905816564 1:40955463-40955485 GAAAATGTGGTGCCTCTATCAGG - Intergenic
907312334 1:53546063-53546085 GACAGTGGTGTGCCTGCATCAGG + Intronic
923023542 1:230186294-230186316 GACAGTGACATACCTGCATCTGG - Intronic
1064013514 10:11755353-11755375 GTTAATGTCGTGCCTCCCTCTGG + Intronic
1068133289 10:52922605-52922627 GACAATGACCTGCTTCTCTCAGG + Intergenic
1073616110 10:104997851-104997873 ATCAATGAAGTGTCTCCATCTGG + Intronic
1080569434 11:33542665-33542687 GACCATGAGGGGCTTCCATCTGG - Exonic
1094740446 12:33282399-33282421 GACAATGACGTCGCTTCATTGGG + Intergenic
1095796717 12:46226984-46227006 CACAATGACGTGCCTTGATGTGG - Intronic
1096428923 12:51527377-51527399 GACAATGAGGGGCCTCAGTCTGG - Intergenic
1100290349 12:93207879-93207901 GTCAATGAAATGCATCCATCTGG + Intergenic
1102633097 12:114299369-114299391 GACAATTAAGTGCCTCCTGCAGG + Intergenic
1103993985 12:124817419-124817441 GACTATGACTTGCCTGCTTCCGG + Intronic
1104655114 12:130568528-130568550 GACAATGACGTGCTCCCCTCTGG + Intronic
1117755704 14:58972099-58972121 GACAATGACGTCGCTTCAACAGG - Intergenic
1128557077 15:68639164-68639186 CACAAGGAGGTGCCTCCTTCAGG - Intronic
1129227015 15:74175975-74175997 GACAACGAGGTGCAGCCATCAGG + Exonic
1138617499 16:58181826-58181848 CACAATGACGTGCCTTCGTATGG - Intronic
1138695293 16:58807384-58807406 GAAAATTACCTGCCTCCAGCTGG - Intergenic
1139823125 16:69736391-69736413 GAGAATGACGAGCCTGCATTGGG - Intergenic
1141850605 16:86642733-86642755 GCCAATAATGTGCCTCCAGCAGG - Intergenic
1143976978 17:10837309-10837331 GACAAAGACGTGGCTCAGTCAGG - Intronic
1144733853 17:17543932-17543954 GTCAGTGACTTGCCTCCATGTGG + Intronic
1152922765 17:83074014-83074036 GACAAGGCCTTGCCTCCTTCGGG + Intergenic
1162525168 19:11202571-11202593 CACAAGGACGTGCCTCCAGCCGG + Exonic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
934120879 2:88838357-88838379 GTCACTGACGTGCCCCCATGGGG - Intergenic
935683780 2:105665210-105665232 GACAATTATGTGCCTACATGTGG + Intergenic
938961607 2:136348817-136348839 AACAATTACCTGCCTCCCTCAGG - Intergenic
947247963 2:228071044-228071066 GACAATGAGGTCCCTTCTTCTGG - Intronic
947977935 2:234383986-234384008 CACACTGACTTGCCTCTATCAGG - Intergenic
948826112 2:240574103-240574125 GACAATGTCGTACCTGCACCGGG - Exonic
1178293675 21:31390829-31390851 GAGAATGAGGAGCCTCCATTTGG - Intronic
1181262923 22:21611555-21611577 GCCAACTACGTGCCTTCATCTGG - Intronic
961981846 3:131087744-131087766 GGCAATGACGTGCAGCCACCAGG + Intronic
962927536 3:140008635-140008657 GCCAATGCTTTGCCTCCATCAGG + Intronic
972661596 4:41121803-41121825 CACAAAGACGTGGCTGCATCCGG - Intronic
982945048 4:161611606-161611628 ACCAATGAGTTGCCTCCATCAGG + Intronic
985795823 5:1961605-1961627 GACCAGGACGTGGCTCCACCTGG - Intergenic
986351652 5:6885673-6885695 GTCAATCAAGTGCCCCCATCAGG - Intergenic
1000110714 5:158105737-158105759 CACGATGACATGGCTCCATCAGG + Intergenic
1001809802 5:174618962-174618984 GACAGTGAAGGGCCTTCATCTGG - Intergenic
1003616629 6:7660505-7660527 GACAGTGACATGCCACCACCTGG + Intergenic
1017791718 6:157805466-157805488 GCCAATTACCTGCCTCCATGTGG + Intronic
1019005061 6:168789900-168789922 GGCAATTAAATGCCTCCATCTGG - Intergenic
1020204552 7:6104932-6104954 GACAATGACGTGCCTCCATCCGG - Exonic
1031997133 7:128240506-128240528 GACAAAAACGTGGCTACATCTGG + Intergenic
1033032821 7:137844271-137844293 GAAAAGGAGGTGCTTCCATCTGG - Intronic
1045122968 8:99058734-99058756 GACAATGACTTAGTTCCATCTGG - Intronic
1048662225 8:136617944-136617966 GACATTGCAGTGCCTCCAACTGG + Intergenic
1051765580 9:20519435-20519457 TATAATGACATGCTTCCATCTGG - Intronic
1052271266 9:26630625-26630647 GATAATGACCTACCTCCAACTGG - Intergenic
1052801244 9:32970131-32970153 GCCACTGACGTGCTTCCATAGGG - Intergenic
1056678317 9:88695516-88695538 GACAGTGACCAGCCTCCACCTGG - Intergenic
1185601295 X:1341279-1341301 GACAAGGGCGAGTCTCCATCAGG + Intronic
1189953944 X:46259471-46259493 GACAATGACGCCGCTTCATCAGG + Intergenic
1193187194 X:78527451-78527473 GATAATGAAGTGCCACCATTTGG - Intergenic
1194211775 X:91079306-91079328 GAAAATGAGGAGCCTCCAGCAGG - Intergenic
1194577659 X:95633673-95633695 GACAATGATTTGCTTCTATCTGG - Intergenic