ID: 1020204558

View in Genome Browser
Species Human (GRCh38)
Location 7:6104954-6104976
Sequence ACAGCCCAGCCGCCCGGCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204558_1020204571 6 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377
1020204558_1020204566 -8 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204566 7:6104969-6104991 TGGGCTGTGTGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 43
4: 430
1020204558_1020204572 7 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204558_1020204569 4 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204558_1020204573 11 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204573 7:6104988-6105010 GCGGCGGCGGCCGAGGGGGATGG 0: 1
1: 1
2: 13
3: 150
4: 1170
1020204558_1020204568 -2 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204558_1020204570 5 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204558_1020204567 -5 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204558_1020204575 28 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204575 7:6105005-6105027 GGATGGAGCGAGCGCCGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 110
1020204558_1020204576 29 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204576 7:6105006-6105028 GATGGAGCGAGCGCCGAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204558 Original CRISPR ACAGCCCAGCCGCCCGGCGG GGG (reversed) Exonic
900436920 1:2635244-2635266 AGAGCCCAGCACCCCGGAGGTGG + Intergenic
900799172 1:4727005-4727027 GGAGCCCAGCCCCCCGGCGTGGG + Intronic
900885632 1:5413462-5413484 ACAGCCCATCGGCCAGGCAGCGG + Intergenic
900990624 1:6096712-6096734 GCAGCCCAGGCGCTCGGCGATGG - Exonic
901425940 1:9182502-9182524 CCAGCCCAGGCGGGCGGCGGCGG - Intergenic
902617721 1:17632950-17632972 ACAGCCCAGCAGCCGGGCTTTGG - Intronic
905463060 1:38133979-38134001 ACGGCCCAGCCGCGCAGCGCAGG + Intergenic
905867138 1:41382464-41382486 GGCGCCCAGCGGCCCGGCGGCGG - Exonic
906062647 1:42958534-42958556 ACAGCGCAGCGGGGCGGCGGGGG + Intronic
906614555 1:47225542-47225564 ACAGCGGAGCTGCCCGGCGACGG - Exonic
906650398 1:47508626-47508648 CCAGCGCAGCCCCCCGGCGGGGG - Intergenic
906740169 1:48174496-48174518 ACAGGGCAGCGGCCGGGCGGGGG - Intergenic
907384599 1:54117888-54117910 ACCGCCCAGCTGCCCAGAGGAGG + Intergenic
912764448 1:112396182-112396204 CCCCCTCAGCCGCCCGGCGGGGG - Exonic
915552312 1:156642288-156642310 GCAGCCCCGCCGCCCGCCGTGGG + Intronic
915553208 1:156646899-156646921 ACAGCCCGGCGGCTCGGCGGTGG - Exonic
922526590 1:226309003-226309025 TCAGCCCACCTGCCCAGCGGAGG + Intronic
923710783 1:236386706-236386728 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
1066214536 10:33273631-33273653 ACAGCACAGCAGCCCGGCAAAGG + Intronic
1067391251 10:45865645-45865667 ACAGGGCAGCTGCCGGGCGGAGG + Intergenic
1067872038 10:49970506-49970528 ACAGGGCAGCTGCCAGGCGGAGG - Intronic
1069419257 10:68231644-68231666 CAAGCCCAGCGGCCCGCCGGCGG - Exonic
1069705749 10:70458365-70458387 ACAGCCCAGGCGCTCAGCGGAGG + Intergenic
1072915486 10:99535287-99535309 ACAGCCACGCGGCGCGGCGGCGG - Exonic
1073136923 10:101225364-101225386 AGAGCCCAGCGGCCCGGAGGCGG + Intergenic
1074495769 10:113978944-113978966 TCAGCCCAGCAACCCGGCGAGGG - Intergenic
1075032092 10:119030274-119030296 GCAGCCCAGCAGCACGGCGGCGG - Exonic
1077309091 11:1880611-1880633 ACAGCCCAGCCCAGCCGCGGAGG - Intronic
1078091766 11:8268510-8268532 GCAGCGCAGGCGGCCGGCGGCGG - Intronic
1083583365 11:63839269-63839291 ACAGCCCAGCCGGGGGTCGGGGG + Exonic
1084313199 11:68328591-68328613 CCAGCCCAGCCGACTGTCGGGGG + Intronic
1084489399 11:69470380-69470402 ACAGCCCAGCCGCACTGGGAGGG + Intergenic
1085284578 11:75351559-75351581 GCAGGGCGGCCGCCCGGCGGGGG - Intronic
1092861520 12:12724059-12724081 CCAGCCCGGCTGCGCGGCGGAGG - Intergenic
1094375388 12:29783692-29783714 ACCGCACACCCTCCCGGCGGCGG - Exonic
1095432095 12:42144919-42144941 CCAGCCCTCCCGCCCGGGGGAGG - Intergenic
1095476180 12:42589507-42589529 GCAGCCCAGCAGCCCCGCAGCGG - Exonic
1096522079 12:52190030-52190052 GCAGCCCAGCTGCCCTGGGGAGG - Intronic
1098288565 12:68933362-68933384 CCAGCTCAGCCGCCCGGCCGCGG - Intronic
1103938219 12:124487614-124487636 ATAGCCTAGCCGCAGGGCGGAGG - Intronic
1103967038 12:124646509-124646531 CCACCCCAGCCGCCCGCCTGTGG + Intergenic
1105582868 13:21717420-21717442 ACTGCTCAGCCGCCTGGTGGAGG - Intergenic
1105668468 13:22586630-22586652 ACAGCCCAGCACACCGGCTGTGG - Intergenic
1106411516 13:29514454-29514476 ACAGCCCCGCCCCCCGGAGGTGG - Exonic
1113455612 13:110446464-110446486 ATAGCCGAGCCGCCTGGCGAGGG - Intronic
1113578326 13:111410334-111410356 ATAGCCCAGGGGCCCGGAGGCGG - Intergenic
1113767462 13:112890061-112890083 ACAGGCAAGCCGCCCCGCAGAGG + Intergenic
1113800441 13:113083579-113083601 ACAGCCCAGGAGCCTGGGGGCGG + Intronic
1114482093 14:23042289-23042311 ACAGCCCAGCCGCCAGCCCGAGG - Exonic
1118316124 14:64727189-64727211 ACAGCCCAGCCCCACTGCTGGGG - Intronic
1118332180 14:64823434-64823456 CCAGACCAGCCGCCCCGCCGCGG + Intronic
1118809070 14:69260628-69260650 CCAGCCCCGCCGCCCGGCAGAGG - Intronic
1122116064 14:99527870-99527892 CCAGCCCTGCCGCCCTGCAGAGG + Intronic
1128987135 15:72230236-72230258 ACCGCCCTGCCTCCCGGCAGCGG + Intronic
1130071130 15:80647630-80647652 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
1132464729 16:72328-72350 AAAGCCCGGCCGCCCCGGGGGGG + Intronic
1132548820 16:545841-545863 ACAGCCCAGGCGTCCGGCCTGGG - Intronic
1132642270 16:983322-983344 GCAGCCCAGCTGCCCGCCGAAGG + Intronic
1132724614 16:1333460-1333482 ACAGCCCCGCATCCCGGGGGAGG + Intergenic
1132745333 16:1433975-1433997 CCAGCCCAGCAGCCCTGCAGTGG - Intergenic
1132778981 16:1612662-1612684 ACAGCCCCGCCGCCCAGCCTTGG - Intronic
1134081418 16:11327508-11327530 ACAGCCCAGTCTCCACGCGGCGG + Intronic
1134995315 16:18734514-18734536 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
1135778687 16:25279775-25279797 GCAGCCCAGCCACCCTGCAGAGG + Intergenic
1136129721 16:28211986-28212008 ACAGCGCGGCCGCCGGGCTGCGG + Intergenic
1136365261 16:29806602-29806624 CCAGCCCGGCCGGCCGGGGGCGG + Exonic
1138420059 16:56893073-56893095 TCAGCCCTCCTGCCCGGCGGGGG + Intronic
1141075877 16:81006571-81006593 CCAGCGCAGCAGCCCGGCTGTGG + Intronic
1141427494 16:83953457-83953479 AGAGCCCTGGCGCCAGGCGGGGG + Intronic
1141651124 16:85393799-85393821 CCAGCCCAGCCACCAGGCTGGGG - Intergenic
1141833677 16:86524200-86524222 ACAGCCCTGCCGCTCAGCTGAGG + Intergenic
1141990128 16:87604527-87604549 ACAGGCGAGCCGCCCGAGGGAGG - Intronic
1142373392 16:89695132-89695154 AGAGCCCAGCCTCACTGCGGTGG + Intronic
1142418619 16:89956906-89956928 AGAGCCCAGCAGCCTGGAGGAGG + Intronic
1142421435 16:89972788-89972810 GCAGACCAGCCGCCCGGCACCGG - Intergenic
1143174955 17:4950177-4950199 CCATACCAGCCGACCGGCGGGGG - Intronic
1143521228 17:7445434-7445456 TCAGGCCAGCCGACCGGCCGGGG + Intronic
1143538684 17:7557224-7557246 ACAGCCCAGACACCTGGCAGAGG - Exonic
1144582086 17:16464821-16464843 ACAGCCCTGCCTCCCTGAGGCGG + Intronic
1148456615 17:47814651-47814673 ACTGCCCAGCTGCCCGGGGGAGG - Intronic
1149614802 17:57988420-57988442 CCACCCCAGCCCCCCCGCGGGGG - Intergenic
1150549038 17:66192103-66192125 GCCGCCCAGCAGCCCGGGGGCGG + Intergenic
1151379782 17:73717733-73717755 ACAACCCAGCCTCCCAGCGCTGG + Intergenic
1152551553 17:81032905-81032927 CCTGCCCAGCCGCCGGGCGGAGG + Intergenic
1152646130 17:81469319-81469341 ACAACCCACCCGCCCGTCCGTGG - Intergenic
1160527765 18:79547530-79547552 ACACCGCAGCCCCCCGGGGGAGG - Intergenic
1160844438 19:1160228-1160250 ACATCCCTGCAGCCCGGCTGGGG + Intronic
1161103910 19:2434009-2434031 GCGGCCCAGGCGCCCGGTGGCGG + Exonic
1161214475 19:3086739-3086761 ACAGCCCTGCAGCCAGGAGGGGG + Intergenic
1161802383 19:6423698-6423720 ACAGCCCAGGAGCCGGTCGGCGG + Intronic
1162435392 19:10654835-10654857 AAAGCCCAGCCGCGGGGAGGCGG - Intronic
1162501073 19:11054272-11054294 ACAGCCCAGATGCCCGGCAGCGG + Intronic
1162561117 19:11418688-11418710 TCAGCGCAGGAGCCCGGCGGAGG - Exonic
1162930711 19:13956211-13956233 GCAGCACAGCGGCCTGGCGGTGG - Exonic
1163329690 19:16628382-16628404 CCCGCCCAGCCGCCCGGCCTAGG + Intronic
1164168519 19:22703016-22703038 ACAGGGCAGCTGCCGGGCGGAGG + Intergenic
1164678441 19:30118533-30118555 CCAGCCCAGCCCCTCTGCGGAGG - Intergenic
925009148 2:468618-468640 ACAGCCCAGGCGCCCAGTGGCGG - Intergenic
925030897 2:649286-649308 ACAGCCCAGGCACCCTGCAGAGG - Intergenic
925911240 2:8574890-8574912 ACAGACCAGCCCGCTGGCGGGGG - Intergenic
927945778 2:27134394-27134416 ACAGCTCTGGCGCCCGGCGCCGG + Exonic
928511995 2:32010731-32010753 CCAGCCCGGCCGCCCGCCGCCGG + Intronic
929065071 2:37964177-37964199 ACAGGGCAGCTGCCGGGCGGAGG + Intronic
935371829 2:102355800-102355822 CCTGCCCAGCCGCGCGGCGCGGG - Intronic
937905736 2:127052010-127052032 CCAGCCCAGCCTCCCAGCGCAGG - Intronic
938069233 2:128299809-128299831 ACAGCCCATCTGCCAGGCGGAGG + Intronic
942084016 2:172427793-172427815 CAAGCACAGCTGCCCGGCGGCGG - Exonic
946200693 2:218069206-218069228 CCAGCCCAGCAGCCTGGAGGGGG - Intronic
946322152 2:218960365-218960387 ACAGCGCAGCAGCTCGCCGGTGG - Exonic
946339191 2:219057405-219057427 CGGGCCCAGCCCCCCGGCGGCGG + Intronic
946339793 2:219059897-219059919 ACAGCCCAGCAGGTTGGCGGCGG - Intronic
947901404 2:233724442-233724464 ACAGGGCAGCTGCCGGGCGGAGG + Intronic
948877434 2:240837135-240837157 ACAGCACAGCGGCCCTGCAGAGG - Intergenic
1168769873 20:408207-408229 ACTGCCCGGCTACCCGGCGGCGG - Exonic
1169718288 20:8644588-8644610 ACAGGGCAGCTGCCAGGCGGAGG - Intronic
1170579174 20:17684937-17684959 ACAGTCCAGCCTCCAGGCTGGGG + Intergenic
1171121897 20:22575762-22575784 ACAGCCCAGGACCCTGGCGGGGG + Intergenic
1175295988 20:57909085-57909107 AGAGCCCAGCTGCCTGGCTGGGG - Intergenic
1175361440 20:58414427-58414449 ACGGGGCAGCCGCCGGGCGGAGG + Intronic
1178610187 21:34073371-34073393 CCAGCCCAGCCCGCCGGCCGCGG - Intronic
1180700878 22:17780926-17780948 AGAGCACAGCAGCCCGGCCGGGG - Intergenic
1181952128 22:26562113-26562135 GAGGCCCAGCGGCCCGGCGGGGG + Intronic
1182146400 22:27999302-27999324 ACAGCCAGGCTGCCCGGCAGTGG + Intronic
1182546819 22:31081426-31081448 CCAGCCCACCCGTCCGGCGCAGG - Exonic
1184201320 22:42971684-42971706 ACAGGGCGGCTGCCCGGCGGAGG - Intronic
1184228287 22:43143245-43143267 ACACCCTGGGCGCCCGGCGGAGG + Exonic
1184280570 22:43435230-43435252 TCAGCACAGCCGCCCGCCCGGGG - Intronic
1184511925 22:44938992-44939014 GCAGCCCAGCAGCCTGGTGGAGG - Intronic
1184856114 22:47147703-47147725 ACAGACCAGGAGCCCTGCGGCGG - Intronic
953385087 3:42501858-42501880 TCAGCCCAGCCTCCCTGGGGAGG + Intronic
954107742 3:48418421-48418443 CCAGCCCAGCAGCCCGCAGGTGG + Intronic
954755270 3:52835805-52835827 GCAGGCCAGCCCCCCTGCGGTGG - Intronic
961385076 3:126518591-126518613 ACAGCTCAGCTGCAAGGCGGTGG + Intergenic
961736279 3:129003903-129003925 ACGGCGCAGCCGCCCAGCGCGGG - Exonic
963870304 3:150408728-150408750 ACAGCCCCACCGCCCGCCCGCGG + Exonic
964819596 3:160755628-160755650 AGAGCCCAGCCGGCCGCCTGCGG + Intronic
968074090 3:195806667-195806689 CCAGCCCAGCCCACCGACGGAGG - Intronic
968089237 3:195889877-195889899 AAAGGCCAGCTGCCCGGCTGGGG + Intronic
968490099 4:885505-885527 CCACCCCAGCAGCCCTGCGGGGG + Intronic
969650880 4:8467259-8467281 ACCCCTCGGCCGCCCGGCGGGGG - Intronic
969912296 4:10457510-10457532 ACAGCTTAGAAGCCCGGCGGGGG - Intergenic
970202877 4:13627484-13627506 CCAGCCCCGGGGCCCGGCGGCGG + Exonic
972670927 4:41213915-41213937 ACAGCCGAGCGGCACAGCGGAGG + Intronic
972939755 4:44182006-44182028 ACAGGGCAGCTGCCAGGCGGAGG - Intronic
973018713 4:45172762-45172784 ACAGCCCAGCACCACGGCTGTGG - Intergenic
975166709 4:71186578-71186600 AGAGCCCAAGCCCCCGGCGGAGG + Intergenic
975908908 4:79245776-79245798 TCCGCCCAGCCGCCCGTCTGGGG + Intronic
979674730 4:123398531-123398553 ACAGCCCAGCGGGCCGAGGGCGG - Intronic
984784830 4:183557828-183557850 ACAGACCTGCCGCCCACCGGCGG + Intergenic
985247846 4:187995416-187995438 AGAGCCCAGACGCCCGGCGTTGG - Intergenic
985486659 5:155760-155782 ACAGCCCAGCCGCCAGGTCTAGG + Intronic
985995678 5:3595839-3595861 AAAGCCCCGCCGCCGAGCGGAGG + Intergenic
986858929 5:11904154-11904176 TCAGCCCGGCCGGCTGGCGGCGG - Intergenic
989633501 5:43511274-43511296 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
990308738 5:54518304-54518326 ACCTTCCAGCCGCCCGGCGCGGG + Exonic
990498586 5:56372688-56372710 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
991052267 5:62285833-62285855 TCAGCCCAGCGACCTGGCGGGGG - Intergenic
995052735 5:107724766-107724788 GCAGCCCCGGCCCCCGGCGGCGG + Intergenic
996054113 5:118965153-118965175 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
998432200 5:142076545-142076567 ACGGGGCAGCTGCCCGGCGGAGG + Intergenic
999255781 5:150209414-150209436 ACAGGCCAGCCGGCCGGCCATGG + Exonic
999696275 5:154190783-154190805 TCCGCCCGTCCGCCCGGCGGCGG - Exonic
1006317482 6:33298975-33298997 AGGGCCCAGGAGCCCGGCGGGGG - Exonic
1007104419 6:39273661-39273683 AGAGCCCAGCCGCCCAGCCCAGG + Intergenic
1007651478 6:43425258-43425280 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
1011588082 6:88947437-88947459 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
1011588230 6:88947888-88947910 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
1016802484 6:148181015-148181037 ACAACCCAGCCACCAGGCTGTGG + Intergenic
1018465447 6:164040140-164040162 ACAGCTCCTCCGCCCGGTGGAGG + Intergenic
1019194534 6:170273413-170273435 ACAGCGCTGCGGCTCGGCGGCGG - Intergenic
1019439096 7:1038039-1038061 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
1019523382 7:1470329-1470351 ACAGCCCTGCCGCGGAGCGGCGG - Exonic
1019669101 7:2268334-2268356 ACAGGGCAGCTGCCGGGCGGAGG - Intronic
1020204558 7:6104954-6104976 ACAGCCCAGCCGCCCGGCGGGGG - Exonic
1020273021 7:6608045-6608067 ACAGCCCCGTAGCCCAGCGGGGG - Exonic
1021877300 7:25060638-25060660 ACAGCGCAGCCTCCTGGGGGCGG - Intergenic
1022721249 7:32943192-32943214 AGAGCCCAGCCGCCGGTGGGCGG + Intergenic
1023529393 7:41136943-41136965 ACAGCACAGCAGCCCAGCCGTGG - Intergenic
1030207351 7:106963971-106963993 AGAGCCACGGCGCCCGGCGGAGG - Intergenic
1032241369 7:130161890-130161912 ACAGCCCTGCCACCCCGCAGGGG - Intergenic
1037834814 8:22209655-22209677 ACAGCACAGCCCCCAGGCTGGGG + Exonic
1039936466 8:42051250-42051272 TCAGCCCAGCCGCCGAGGGGAGG - Intronic
1040928714 8:52713335-52713357 ACAGCACATCCACCAGGCGGTGG + Intronic
1044629171 8:94262348-94262370 CCAGCCCAGCCGACCCGCCGCGG + Intronic
1045583327 8:103501196-103501218 ACAGCCCGGGCGGCCGGCGCTGG - Intronic
1049194567 8:141308225-141308247 ACCGCCCGGCCGGCCGGCCGAGG - Intronic
1049761045 8:144332161-144332183 ACATCCCAGGCCCCCGGCGTCGG + Exonic
1052603542 9:30670994-30671016 ACAGCCCAGATGCCCGGTTGCGG + Intergenic
1053129043 9:35605192-35605214 CCAGCCCGGCCTCCCGGCAGCGG - Intergenic
1055454396 9:76459330-76459352 CCTGCTCGGCCGCCCGGCGGTGG + Intronic
1057313461 9:93955279-93955301 TCCGCCCGGCCGGCCGGCGGGGG - Exonic
1062375806 9:136261418-136261440 TCAGCCCACCCTCCTGGCGGAGG - Intergenic
1186182473 X:6986427-6986449 ACAGCCCAGGGGCTCGGCGCAGG + Intergenic
1189570028 X:42285822-42285844 ACAGGGCAGCTGCCGGGCGGAGG + Intergenic
1189955805 X:46275502-46275524 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
1191637367 X:63393231-63393253 ACAGGGCAGCTGCCGGGCGGAGG - Intergenic
1192386776 X:70679616-70679638 ACAGCGCGGCTGCCGGGCGGAGG - Intronic
1198100070 X:133415443-133415465 AGGGCACAGCCGCGCGGCGGAGG - Exonic
1198600821 X:138282861-138282883 ACAGGGCAGCTGCCAGGCGGAGG + Intergenic