ID: 1020204559

View in Genome Browser
Species Human (GRCh38)
Location 7:6104955-6104977
Sequence CACAGCCCAGCCGCCCGGCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 231}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204559_1020204567 -6 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204559_1020204571 5 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377
1020204559_1020204573 10 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204573 7:6104988-6105010 GCGGCGGCGGCCGAGGGGGATGG 0: 1
1: 1
2: 13
3: 150
4: 1170
1020204559_1020204566 -9 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204566 7:6104969-6104991 TGGGCTGTGTGCGGCGGCGGCGG 0: 1
1: 0
2: 5
3: 43
4: 430
1020204559_1020204576 28 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204576 7:6105006-6105028 GATGGAGCGAGCGCCGAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 111
1020204559_1020204568 -3 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204559_1020204569 3 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204559_1020204570 4 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204559_1020204572 6 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204559_1020204575 27 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204575 7:6105005-6105027 GGATGGAGCGAGCGCCGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204559 Original CRISPR CACAGCCCAGCCGCCCGGCG GGG (reversed) Exonic
900091867 1:924234-924256 GACTGCCCAGCCGGCCGGCGGGG - Intergenic
900226630 1:1536181-1536203 CACAGCTCACCCGCCCGCCCCGG + Intronic
900396276 1:2454458-2454480 CACAGACCATCCTCCCGGAGGGG - Intronic
900423867 1:2567407-2567429 CACACCCCAACCTCCCGGCAGGG + Intergenic
900623798 1:3599074-3599096 CACAGCCCAGAAGCCAGACGAGG + Intronic
900783621 1:4633836-4633858 CACAGCCCAGGAGCAGGGCGGGG + Intergenic
900799171 1:4727004-4727026 GGGAGCCCAGCCCCCCGGCGTGG + Intronic
902477027 1:16693705-16693727 CGCAGGCCGGCCGCCCAGCGCGG + Intergenic
902823438 1:18956870-18956892 CTCCGCCCAGCTCCCCGGCGGGG + Intergenic
902916755 1:19644326-19644348 CGCAGCCCAGCCGAGCGTCGCGG + Intronic
903163076 1:21503096-21503118 CACCTCCCAGCCGCCCGCCTTGG - Intergenic
903413709 1:23167875-23167897 CCCCGCCCAGCCGCCCGGGCAGG - Intronic
903494969 1:23759735-23759757 CACAGCCCCGCCTCCCTGCCTGG + Exonic
906062646 1:42958533-42958555 CACAGCGCAGCGGGGCGGCGGGG + Intronic
906650400 1:47508627-47508649 CCCAGCGCAGCCCCCCGGCGGGG - Intergenic
906921955 1:50074116-50074138 CACAGCCCAGCCAGCCAGCCAGG - Intronic
907541017 1:55215380-55215402 CGCGGCCCCGCCGCCCGGGGAGG - Intergenic
912401442 1:109397399-109397421 CACAGCCCCGCCGGCCGCCCGGG + Intronic
912802462 1:112728701-112728723 CACCTCCCAGCCGCCTGGCTTGG + Intergenic
915552311 1:156642287-156642309 CGCAGCCCCGCCGCCCGCCGTGG + Intronic
916783017 1:168056465-168056487 CCCCGCCCCGCCTCCCGGCGCGG - Intronic
917964158 1:180168014-180168036 CACTGCCCAGCCCCCAGGGGAGG + Intronic
922768182 1:228166579-228166601 CACAGCTCTGCCACCAGGCGGGG - Intronic
1062882253 10:988306-988328 CACAGCGCACCCGCCCGGCTTGG - Exonic
1062974538 10:1673806-1673828 CACAGCCCAGCTGCCCCTCCTGG - Intronic
1063393686 10:5666604-5666626 CCCCGCCCAGCGGCCCCGCGCGG - Intergenic
1063776647 10:9273098-9273120 CTCTGCCCGGCCGCCCGGCCTGG - Intergenic
1063776730 10:9273297-9273319 CTCTGCCCGGCCGCCCGGCCTGG - Intergenic
1067120174 10:43465826-43465848 CACATCCCAGCCGCCTGCCTTGG - Intronic
1067375858 10:45727300-45727322 ACCATCCCAGCCGCCCGGCTCGG - Exonic
1069705770 10:70458432-70458454 TCCAGCCCAGCCGGCCGGCCTGG - Intergenic
1070162298 10:73873899-73873921 CACTGCCCAGCCGCGGGGCTGGG + Intronic
1070685143 10:78475039-78475061 CACAGCCCAGCCACCTGGCAGGG - Intergenic
1072892952 10:99341252-99341274 CACAGCCCAGGAGCCCAGCATGG - Intronic
1073216818 10:101841024-101841046 CACTGCCCAGCGGCCCCGCCGGG + Intronic
1074356739 10:112792418-112792440 CACAGCCCAGCAGCCCACCTGGG + Intronic
1074377699 10:112952430-112952452 CTCAGCCCTGCTGCCCTGCGCGG - Intronic
1074495770 10:113978945-113978967 CTCAGCCCAGCAACCCGGCGAGG - Intergenic
1076133344 10:128028644-128028666 CACAGCTGAGCAGCCCGCCGGGG + Intronic
1076139065 10:128065105-128065127 CACAGCCCCGCAGCCCCGCCCGG + Intronic
1076406701 10:130217016-130217038 CACAGGGCAGCCACCGGGCGCGG - Intergenic
1076787323 10:132757784-132757806 CACAGCCCAGCACCATGGCGTGG + Intronic
1076787366 10:132757936-132757958 CACAGCCCAGCACCATGGCGTGG + Intronic
1076787528 10:132758480-132758502 CACAGCCCAGCACCATGGCGTGG + Intronic
1076859086 10:133131752-133131774 CACAGCCCAACCACCCTGAGGGG + Intergenic
1076995216 11:294424-294446 CACAGCTCAGCCTCCAGGTGAGG - Exonic
1077295631 11:1825139-1825161 CCCAGCCCAGCCTGCCGGCCTGG - Intergenic
1077479397 11:2806568-2806590 CACGGCCCAGCTGCTCGGTGGGG - Intronic
1078003266 11:7514079-7514101 CACACCTGAGCCGCCCGGAGAGG + Exonic
1078594423 11:12674494-12674516 CGCGGCCCCGCCGCCCGCCGCGG + Intergenic
1083583364 11:63839268-63839290 CACAGCCCAGCCGGGGGTCGGGG + Exonic
1084284196 11:68121078-68121100 CGCGGCCCCGGCGCCCGGCGTGG - Exonic
1084489398 11:69470379-69470401 CACAGCCCAGCCGCACTGGGAGG + Intergenic
1084529169 11:69717041-69717063 CACATCCCAGCCGCTTGGCCTGG - Intergenic
1085325407 11:75602547-75602569 CAGAGCCCAGCCTCCCAGTGTGG + Intronic
1085619975 11:78030668-78030690 TAAAGCCCAGCCGCCTGGAGGGG - Intronic
1087214647 11:95482175-95482197 CACATCCCAGCCGCCTGCCTTGG + Intergenic
1090839366 11:130475150-130475172 CACAGCCCAGCCCCCTGTTGGGG + Exonic
1092229060 12:6766784-6766806 CGCAGCCCTGGGGCCCGGCGCGG + Intronic
1093641078 12:21527629-21527651 CACAGCGCAGTCCCCGGGCGTGG - Intronic
1095476283 12:42589921-42589943 CGCAGCCCTGCCCCCGGGCGCGG - Intronic
1096848173 12:54419147-54419169 CCCAGCGCAGCTGCACGGCGTGG + Exonic
1100391312 12:94148370-94148392 CAAAGCTCAGCCGCCCGCCGCGG - Intergenic
1103458522 12:121086014-121086036 CACTGCCCAGCAGCCCGGTTTGG - Intergenic
1103563515 12:121804397-121804419 GCCCGCCCGGCCGCCCGGCGTGG - Intronic
1105031500 12:132887442-132887464 CGCAGCCCCGCAGCCCGGCCTGG + Intronic
1106208760 13:27621811-27621833 CAGGGCCCAGCCGCGGGGCGGGG - Exonic
1106422622 13:29595903-29595925 CGCAGCCCGCCCGCCCGCCGCGG - Intergenic
1107831081 13:44374136-44374158 CAGAGCCCTGCAGCCCGGCGGGG + Intronic
1108555183 13:51584630-51584652 CTCAGCCCGGCCCCGCGGCGCGG + Exonic
1113378334 13:109783677-109783699 CGCAGCCCTGCACCCCGGCGGGG - Exonic
1113455613 13:110446465-110446487 GATAGCCGAGCCGCCTGGCGAGG - Intronic
1115664747 14:35534478-35534500 CTCACCCCAGCCGCCCGACATGG - Exonic
1117221674 14:53612416-53612438 CACAGCCCACAGGCCAGGCGCGG + Intergenic
1117411752 14:55456622-55456644 CACATCCCAGACGGGCGGCGGGG + Intronic
1118316125 14:64727190-64727212 CACAGCCCAGCCCCACTGCTGGG - Intronic
1119539354 14:75428359-75428381 CCCAGCCCAGCCCCGCGGGGAGG + Intronic
1120891360 14:89494441-89494463 GACAGCCCAGCCGGCAGGCTAGG - Intronic
1121306907 14:92912331-92912353 CACATCCCAGCCGCCTGCCTTGG - Intergenic
1122806632 14:104263182-104263204 CACACCCCAGCCCCCTGGGGAGG + Intergenic
1122922750 14:104886716-104886738 CCCAGCCCAGCCCCCCAGCACGG + Exonic
1123121868 14:105920439-105920461 CACAGCCCAGCCCCCCGTGCTGG - Intronic
1128416041 15:67447084-67447106 CACAGCTCAGCGGCAGGGCGAGG - Intronic
1128994887 15:72288913-72288935 CCCAGCCCAGAGCCCCGGCGTGG - Exonic
1131108538 15:89750442-89750464 CACAGCCCCACCGCCCGCCAAGG - Intronic
1132548821 16:545842-545864 CACAGCCCAGGCGTCCGGCCTGG - Intronic
1132861022 16:2071865-2071887 CGGACCCCAGCCGCACGGCGGGG - Exonic
1132865201 16:2089811-2089833 CACTGCCCAGCCGCCTTGCCCGG - Exonic
1135295814 16:21278357-21278379 CACAGCCCAGCCTCCGGGGGCGG + Intronic
1135562015 16:23483932-23483954 CACAGCCCAGCCGGGCGCAGTGG - Intronic
1136070623 16:27784914-27784936 CACAGCTCAGCTCCCGGGCGAGG + Intergenic
1137436200 16:48455883-48455905 CCCAGCCAAGCCCCCCGGGGAGG + Intergenic
1138350473 16:56343947-56343969 CTGAGCCCAGCCGCCCTGCCCGG + Exonic
1138471997 16:57245295-57245317 CAGGGCGCGGCCGCCCGGCGGGG - Exonic
1139952630 16:70679561-70679583 CACAGCCCCACCGCCCCGTGGGG - Intronic
1141086059 16:81096321-81096343 CCCCGCCCCGCCTCCCGGCGCGG - Exonic
1141427493 16:83953456-83953478 CAGAGCCCTGGCGCCAGGCGGGG + Intronic
1141651126 16:85393800-85393822 CCCAGCCCAGCCACCAGGCTGGG - Intergenic
1141811947 16:86381795-86381817 CACAGCCCAGCCCCCTTGCTAGG - Intergenic
1142239229 16:88937586-88937608 CACAGCGCAGGAGCCCGACGCGG - Intronic
1142292565 16:89199738-89199760 CACAGCCCAGCAGCCAGCCCAGG + Exonic
1142343952 16:89542058-89542080 CAGAGCCCAGCCACCCTGCGGGG - Intronic
1142351865 16:89584290-89584312 CCCAGCCCAGCTGCCAGGAGGGG - Intronic
1142412475 16:89923584-89923606 CGCGTCCCGGCCGCCCGGCGCGG - Intronic
1142549934 17:732398-732420 CCCCGCCCACCCGCCCGCCGGGG + Exonic
1142663894 17:1450466-1450488 CACTGCCCTCCGGCCCGGCGTGG + Intronic
1142850967 17:2704599-2704621 GACAGCCCCGCCGACCAGCGAGG - Intronic
1144816668 17:18039794-18039816 CAACACCCAGCAGCCCGGCGTGG + Exonic
1148534806 17:48430238-48430260 CCCAGCCCGGCCGCGGGGCGGGG + Intronic
1149614804 17:57988421-57988443 CCCACCCCAGCCCCCCCGCGGGG - Intergenic
1149997125 17:61411264-61411286 CAAGGCCCAGCCGCCGGCCGCGG - Intergenic
1150311266 17:64130662-64130684 CACGGCGCAGCTGCCCCGCGCGG + Intronic
1150338339 17:64345882-64345904 CACAGCCCAGCGGCTCTACGGGG + Intronic
1150518203 17:65837160-65837182 CACATCCCAGCCGCCTGCCTTGG + Intronic
1150618215 17:66788853-66788875 CACAGCCCAGCCGCTTGGCTGGG - Exonic
1152630755 17:81409784-81409806 CACAGCCCAGCCTGCTGGGGAGG - Intronic
1152820243 17:82434116-82434138 GCCAGCCCAGCCGCCCGGGGTGG - Intronic
1152834418 17:82519977-82519999 CACGGCCCAGCCGCCCGGCGGGG - Exonic
1152921961 17:83070248-83070270 CCCAGCCCAGCCGGTCAGCGCGG + Intergenic
1152924172 17:83079920-83079942 CGCCGCCCAGCAGCCCGGCCAGG - Exonic
1157576276 18:48746033-48746055 CACAGCCCAGCCACCCTTCTGGG - Intronic
1157794041 18:50559458-50559480 CACAGCCCAGGCGGCCCGCTCGG + Intergenic
1160024889 18:75209113-75209135 CACAGCCGAGCCGAGCGGCCCGG - Exonic
1160844437 19:1160227-1160249 CACATCCCTGCAGCCCGGCTGGG + Intronic
1160991693 19:1862899-1862921 CCCCGCCCTGCCGGCCGGCGCGG + Intronic
1161059753 19:2209077-2209099 CACAGCCCTGCCGCCCCTCGGGG + Intronic
1161752102 19:6105603-6105625 CTCAGCCCAGCAGCCAGACGGGG - Intronic
1161752931 19:6110561-6110583 CGCAGCCCGCCCGCCCGACGGGG + Intronic
1162984302 19:14259590-14259612 AACAGCCCATCGGCCGGGCGCGG - Intergenic
1163548102 19:17951069-17951091 CCCTCCCCAGCCCCCCGGCGGGG - Intergenic
1163548390 19:17952176-17952198 CCCCGCCCCGCCGCCCGGGGAGG - Intronic
1164855489 19:31517623-31517645 CACAGCCCGGCCCCCCTGCTTGG - Intergenic
1165419413 19:35715654-35715676 CAAAGCCCAGCCCCCGGGGGAGG + Intronic
1166142225 19:40811326-40811348 CACAGCCCCACCGCAGGGCGCGG + Intronic
1167237187 19:48322094-48322116 CACTGCCCGCCCGCCCGGGGAGG - Intronic
1167652406 19:50739731-50739753 CCCAGCCCTGCCGCCTGGCTGGG - Intergenic
1168702775 19:58451645-58451667 CACAGCCCAGACCACCGGTGTGG - Exonic
925294067 2:2766277-2766299 CACTGCCCAGCCACCCAGCATGG + Intergenic
925911241 2:8574891-8574913 CACAGACCAGCCCGCTGGCGGGG - Intergenic
926097518 2:10091646-10091668 CCCAGCCCTGCCCCGCGGCGCGG - Intergenic
926107610 2:10162209-10162231 CACAGCCGAGCTGCCAGGCCAGG + Intronic
927640173 2:24841043-24841065 CACAGCCCAGGGGACCTGCGAGG - Intronic
929583687 2:43100788-43100810 CAAAGTGCAGCCGCCCGGGGAGG + Intergenic
931216217 2:60247463-60247485 CACGGCCCAGCCGCCCTCCTGGG + Intergenic
931719512 2:65056791-65056813 CCAAGCCCAGCCGCCCGCCTCGG - Intronic
935371831 2:102355801-102355823 TCCTGCCCAGCCGCGCGGCGCGG - Intronic
937060906 2:118979788-118979810 CACAGCCCAGCCACCAGCAGTGG - Intronic
938074134 2:128322871-128322893 CACAGTCCCGCTGCCCGGGGAGG - Intergenic
938116173 2:128604202-128604224 CACAGCCCAGGCACCCAGGGAGG + Intergenic
944496062 2:200307487-200307509 CCCAGCCCACCCGCGCAGCGCGG - Intronic
946200695 2:218069207-218069229 CCCAGCCCAGCAGCCTGGAGGGG - Intronic
947800884 2:232928040-232928062 CCCAGCCCAGGGCCCCGGCGTGG - Intronic
948216516 2:236237244-236237266 CACAGCCCAGCCGCCGGCGCCGG - Intronic
948360069 2:237413542-237413564 CCCAGCGGAGCCGCCCGGCAGGG + Intronic
948479055 2:238239312-238239334 CCCAGCCCACCCGGCCCGCGGGG + Intronic
948625654 2:239266417-239266439 CACAGCCCACCTGCCCAGGGGGG + Intronic
948740082 2:240040874-240040896 CCCAGCCCAGCTGCCCGGGGAGG + Intergenic
948803736 2:240444170-240444192 CCCAGCCCAGCCGCCACGCCCGG + Intronic
949017974 2:241724314-241724336 CATCCCCCAGCCGCACGGCGTGG - Intronic
1170579173 20:17684936-17684958 CACAGTCCAGCCTCCAGGCTGGG + Intergenic
1170623411 20:18012417-18012439 CACGGCCCACCCGCCCACCGAGG + Intronic
1170623424 20:18012460-18012482 CACGGCCCACCCGCCCACCGAGG + Intronic
1171896188 20:30812558-30812580 CACAGCCCCGTTGGCCGGCGGGG + Intergenic
1174607092 20:51768638-51768660 CACGGCCCGGCCGCCCCCCGTGG - Intergenic
1180094712 21:45550620-45550642 CAAGGCCAAGCCTCCCGGCGGGG - Intergenic
1181139103 22:20790995-20791017 CCCACCCCAGCAGCCCGGAGAGG + Intronic
1181902784 22:26169675-26169697 CGCGGCCCGGCCGCCCGCCGCGG + Exonic
1181954623 22:26579410-26579432 CACAGCCCTGGGGCCCGGTGGGG + Intronic
1183349073 22:37324748-37324770 CTCAGCCCATCGGCCCTGCGCGG + Intergenic
1183943258 22:41308718-41308740 CACAGCCCTGGCTCCCGGCATGG + Intronic
1184257174 22:43293988-43294010 CAAGGCCCAGCCGCCCTGCCAGG - Intronic
1184272985 22:43395439-43395461 CCCACCCCAGCCGCTCAGCGTGG + Intergenic
1184280571 22:43435231-43435253 CTCAGCACAGCCGCCCGCCCGGG - Intronic
950196873 3:11015556-11015578 CACAGCCCAGACGCCCTGGCAGG + Intronic
953963212 3:47282556-47282578 CACAGCCAGGCAGCCCCGCGTGG - Exonic
954367703 3:50155171-50155193 CCCAGCGCGGCCGCCCGGCCCGG + Exonic
956674929 3:71724989-71725011 CGCCGAACAGCCGCCCGGCGCGG + Intronic
956676718 3:71740847-71740869 CACATCCCAGCCGGCCGCGGTGG + Intronic
961654299 3:128432968-128432990 CCCAGCCCCGCCGCCCCGCCTGG + Intergenic
961736280 3:129003904-129003926 CACGGCGCAGCCGCCCAGCGCGG - Exonic
961754626 3:129120865-129120887 CCCAGCTCAGCCCACCGGCGGGG - Intronic
963040450 3:141066190-141066212 CAGAGCCCGGGCGGCCGGCGCGG + Exonic
968048039 3:195635131-195635153 CTCAGCCCAGCCGCGCGCCTTGG + Intergenic
968099363 3:195954489-195954511 CTCAGCCCAGCCGCGCGCCTTGG - Intergenic
968306572 3:197654790-197654812 CTCAGCCCAGCCGCGCGCCTTGG - Intergenic
968490097 4:885504-885526 CCCACCCCAGCAGCCCTGCGGGG + Intronic
968726331 4:2249542-2249564 CACTGCCCAGCAGCCCGGTTAGG - Exonic
969113915 4:4859848-4859870 CACTGGCCAGCCGCCGGGCATGG - Exonic
969650881 4:8467260-8467282 CACCCCTCGGCCGCCCGGCGGGG - Intronic
972765710 4:42151402-42151424 CACAGCCGTGCTTCCCGGCGCGG + Intronic
973686818 4:53378144-53378166 CACAGCCCCCCAGCCCGGCCCGG - Intronic
974021322 4:56693926-56693948 CACCTCCCAGCCGCCCGCCTTGG - Intergenic
975865664 4:78721295-78721317 CACAGCCCAGACTCCCTTCGGGG + Intergenic
975908907 4:79245775-79245797 CTCCGCCCAGCCGCCCGTCTGGG + Intronic
976398484 4:84582838-84582860 CACAGCCCCGCCTCCCCGTGAGG - Intergenic
989185809 5:38624747-38624769 AATAGACCAGCCGCCGGGCGCGG - Intergenic
990308737 5:54518303-54518325 CACCTTCCAGCCGCCCGGCGCGG + Exonic
990410186 5:55534485-55534507 CACACCCCCGCTGCCCGTCGCGG + Intronic
990709199 5:58563600-58563622 CTCTGCCCAGCCGCCCCGCCTGG - Intergenic
991052268 5:62285834-62285856 CTCAGCCCAGCGACCTGGCGGGG - Intergenic
995402476 5:111757881-111757903 CACAGCCCGGCGGCCCGCCAGGG + Intronic
997297411 5:132776894-132776916 CCCCGACCAGCCGCCCGGCAAGG + Intronic
997297494 5:132777146-132777168 CCCAGCCCACCCGCCCGGTGCGG - Exonic
997433522 5:133857925-133857947 CTCTGCCCAGCCGCCCCGCTGGG - Intergenic
997667826 5:135646252-135646274 CAGAGCCAAGCCGGCCGGAGAGG - Intergenic
998208394 5:140175520-140175542 CACCGCCGAGACGCGCGGCGCGG - Intronic
1001381520 5:171309453-171309475 GACAGCGCACCCGCCCCGCGGGG + Exonic
1002031444 5:176433479-176433501 CACATCCCAGCCGCCTGCCTTGG + Intergenic
1002626131 5:180531129-180531151 CTCCGCCCAGCCGCCCGGTCTGG - Intronic
1003178264 6:3770232-3770254 CGTTGCCCAGCAGCCCGGCGGGG + Intergenic
1004524296 6:16391849-16391871 CAAAGCCCAGCAGCCTGGAGGGG + Intronic
1006188908 6:32195935-32195957 CCCAGCCTCGCGGCCCGGCGTGG + Exonic
1006524139 6:34589330-34589352 CACAGCCCCGCCTCCCTGCCAGG - Exonic
1006854845 6:37125635-37125657 CACAGCCCGTCGGCCCGGCGCGG - Intergenic
1006984756 6:38169088-38169110 CACAGCCCGGCCGCCCAGGCTGG - Exonic
1007673483 6:43575958-43575980 CCCACCCCCGCCGCCCGCCGCGG - Exonic
1016476559 6:144433981-144434003 CACATCCCAGCCGCCTGCCTTGG - Intronic
1019179317 6:170176822-170176844 CTCAGCACAGCCGCCCAGCCTGG + Intergenic
1019565253 7:1675839-1675861 CACAGCACAGCTGCCCCGCCAGG + Intergenic
1019745843 7:2700065-2700087 CACAGCACTGCCACCCAGCGAGG - Intronic
1020204559 7:6104955-6104977 CACAGCCCAGCCGCCCGGCGGGG - Exonic
1024118058 7:46211501-46211523 CACAGCCCTGCGGCCTGGGGTGG + Intergenic
1024564297 7:50668753-50668775 CACAGCCCTGCCAACCGGTGGGG + Intronic
1028223040 7:88219450-88219472 CGCATCCCAGACGCCCGGCGAGG + Intronic
1028712140 7:93921746-93921768 CCCAGCCCAGCCGTCCCCCGCGG + Exonic
1029114745 7:98231379-98231401 CACAGAACAGGCGCCCGGCAGGG + Intronic
1029525608 7:101092145-101092167 CACCTCCCAGCCGCCCGCCTTGG + Intergenic
1030347951 7:108455278-108455300 CAGCGCCCACCCGCGCGGCGTGG + Intronic
1032241370 7:130161891-130161913 CACAGCCCTGCCACCCCGCAGGG - Intergenic
1033185794 7:139226018-139226040 CTCTGCCCAGCCGCCCGTCTAGG + Intergenic
1033657066 7:143381547-143381569 CCCACCCCAGCAGCCCGGCCCGG + Exonic
1034544896 7:151783165-151783187 CGCAGCACAGCCTCCCCGCGCGG + Intronic
1044582079 8:93833989-93834011 CCCTGCCCAGCCGCCCCGCCTGG - Intergenic
1044582192 8:93834351-93834373 CTCTGCCCAGCCGCCCCGCCTGG - Intergenic
1045501192 8:102745572-102745594 CCCAGCCCAGACGCACCGCGTGG + Intergenic
1049451704 8:142665441-142665463 CACAGCCCCGCCTTCCGGAGTGG + Exonic
1052259276 9:26493315-26493337 CTCTGCCCAGCCGCCCCGCCTGG + Intergenic
1053081810 9:35183573-35183595 CTCTGCCCAGCCGCCCTGCCTGG - Intronic
1053135277 9:35646923-35646945 CGCAGCGCCGCCGCCTGGCGAGG - Intergenic
1054337037 9:63816872-63816894 CACAGCCCCGTTGGCCGGCGGGG - Intergenic
1057313462 9:93955280-93955302 CTCCGCCCGGCCGGCCGGCGGGG - Exonic
1060036181 9:120257673-120257695 CACAGCTCAGCCACCCGGGCTGG - Intergenic
1061161665 9:128899037-128899059 CACAGCCCAGCAGTCTGACGCGG + Intronic
1061241726 9:129378484-129378506 CACAGCCCTGCAGCCAGGGGTGG + Intergenic
1061942287 9:133890218-133890240 CACTGCCCAGACTCCCGGCCTGG - Intronic
1062627296 9:137449108-137449130 CACAGCTGAGCCTCCAGGCGAGG + Exonic
1062639995 9:137514230-137514252 CACAGCCCAGCCACAGGGCCCGG - Intronic
1062640148 9:137514709-137514731 CACAGCCCAGCCACAGGGCCCGG - Intronic
1062640206 9:137514905-137514927 CACAGCCCAGCCACAGGGCCCGG - Intronic
1203376971 Un_KI270442v1:384295-384317 CACAGCCCCGTTGGCCGGCGGGG - Intergenic
1186743839 X:12545611-12545633 CACAGCCCATCCCCCCAGCCTGG - Intronic
1189234656 X:39477851-39477873 CACAGGCCAGCCTTCCGGCTTGG + Intergenic
1192663569 X:73067815-73067837 CACTGCCCAGCCGCCCCGTCTGG + Intergenic
1195370270 X:104166492-104166514 CGCAGCGCCGCCGCCCGGCCCGG - Intergenic