ID: 1020204561

View in Genome Browser
Species Human (GRCh38)
Location 7:6104957-6104979
Sequence CACACAGCCCAGCCGCCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 215}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204561_1020204573 8 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204573 7:6104988-6105010 GCGGCGGCGGCCGAGGGGGATGG 0: 1
1: 1
2: 13
3: 150
4: 1170
1020204561_1020204567 -8 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204561_1020204575 25 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204575 7:6105005-6105027 GGATGGAGCGAGCGCCGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 110
1020204561_1020204568 -5 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204561_1020204572 4 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204561_1020204571 3 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377
1020204561_1020204570 2 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204561_1020204569 1 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204561_1020204576 26 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204576 7:6105006-6105028 GATGGAGCGAGCGCCGAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204561 Original CRISPR CACACAGCCCAGCCGCCCGG CGG (reversed) Exonic
900091869 1:924236-924258 CGGACTGCCCAGCCGGCCGGCGG - Intergenic
900129526 1:1081506-1081528 CACGCAGCCCGGCCGGCCGATGG + Intergenic
900140442 1:1137377-1137399 CACTCAGCCCCGCCCCCCGCAGG + Intergenic
900165455 1:1242678-1242700 GCCACAGCCCAGCCACTCGGTGG + Intronic
900410443 1:2510227-2510249 CACCCAGCCCAGCCACTCGAAGG - Intronic
902329423 1:15724017-15724039 CACACAGCCCATACGGCCAGTGG - Intronic
903266761 1:22162582-22162604 CACACAGCCCAGCAGCCCTGGGG + Intergenic
911924781 1:103816625-103816647 CACACTGCCCTGCAGCCCAGTGG + Intergenic
917721742 1:177792453-177792475 CACACACCCCATCCACCCAGGGG - Intergenic
918045065 1:180936492-180936514 GACCCAGCCCAGCCGCCCTCAGG + Exonic
918659793 1:187074168-187074190 CGCACAGCCCAGGTGCCCGCAGG + Intergenic
920174138 1:204089679-204089701 CACACAGCCCTGGTGCCCGCAGG - Intronic
922187851 1:223292364-223292386 CACACAGCCCTGCACCCCTGTGG + Intronic
922420722 1:225459735-225459757 CACCCAGCCCAGAAGCCCTGGGG - Intergenic
922883050 1:228997076-228997098 CACACAGGACATCCGCCCTGAGG - Intergenic
924567092 1:245207980-245208002 CACACAGCCCACCTCCGCGGGGG - Intronic
1063364939 10:5485009-5485031 CATCCAGCCCAGCCACCCTGAGG + Intergenic
1067273875 10:44817898-44817920 CACACAGCCCTGCAGCACAGAGG + Intergenic
1072210809 10:93245282-93245304 CACACAGCCCAGCCTCCCACCGG - Intergenic
1073136922 10:101225361-101225383 AAGAGAGCCCAGCGGCCCGGAGG + Intergenic
1073320822 10:102615441-102615463 CACCCAGCTCAGCCTCCAGGGGG + Intronic
1074585858 10:114767801-114767823 CTCCCAGCCCAGACGCGCGGCGG + Intergenic
1075032093 10:119030277-119030299 CGCGCAGCCCAGCAGCACGGCGG - Exonic
1075100487 10:119502922-119502944 CCCACAGCCCAGGCGCACGAGGG - Intronic
1075516027 10:123109006-123109028 CCCACAGCCCAGCTTCCCTGGGG + Intergenic
1076743430 10:132499658-132499680 CACACAGCAAAGCTACCCGGAGG - Intergenic
1077243930 11:1526790-1526812 CACACATCCCAGAGGCCCCGTGG + Intergenic
1077415728 11:2423456-2423478 CACACAGCCCACCCGCTCCCAGG + Intergenic
1077453494 11:2664530-2664552 CCCACACCCCTGCCGCCAGGCGG - Intronic
1077479399 11:2806570-2806592 GACACGGCCCAGCTGCTCGGTGG - Intronic
1077544476 11:3163365-3163387 CACACAGCCCTTCCACCCGCCGG + Intronic
1079195325 11:18322020-18322042 CTCACAGACCAGCAGCCCGGAGG + Exonic
1080493590 11:32794436-32794458 GACACAGCCCAGCAGTCAGGAGG + Intronic
1080728031 11:34916663-34916685 ATCACAGCCCAGCCTCCAGGAGG - Exonic
1081805569 11:45888138-45888160 CACACAGCCCTGCCTACAGGCGG - Intronic
1083611797 11:64007877-64007899 CACACAGCCCCGCCTCCAGAGGG + Intronic
1084087094 11:66859750-66859772 GGCACAGCCCAGCAGCCTGGTGG - Exonic
1084769852 11:71335505-71335527 CACACAGCCCAGAGGCCAGCTGG - Intergenic
1085619977 11:78030670-78030692 CCTAAAGCCCAGCCGCCTGGAGG - Intronic
1090839363 11:130475148-130475170 CCCACAGCCCAGCCCCCTGTTGG + Exonic
1091225014 11:133951797-133951819 CACGGAGCCCAGCCTCCTGGGGG - Intronic
1091374642 12:17614-17636 CACATAGCCCAGGAGCCAGGGGG - Intergenic
1094375382 12:29783683-29783705 CCCGCAGCCCCGCCGCCGGGAGG + Exonic
1095414813 12:41965237-41965259 CACACAGCCCTTCAGCCAGGTGG + Intergenic
1096694315 12:53339023-53339045 CCCTCAGCCCAGCCTCCCAGGGG + Intronic
1101246065 12:102885436-102885458 CGCGGAGCCCAGCCGCCCGCCGG - Intronic
1101756003 12:107621014-107621036 CACACAGCCCAGCCCGGCAGGGG - Intronic
1101990757 12:109482679-109482701 CACACAGCACTGACCCCCGGAGG - Intronic
1103738509 12:123076201-123076223 CACACCGCCCAGATGCCAGGAGG + Intronic
1104865385 12:131950299-131950321 CCCCCAGCCCAGGAGCCCGGGGG - Intronic
1104897004 12:132169346-132169368 CACGCAGCCCACCCTCCCTGAGG - Intergenic
1104897017 12:132169380-132169402 CACGCAGCCCACCCTCCCCGAGG - Intergenic
1105060544 12:133146351-133146373 CACACAGCTCACCCTCCCTGGGG + Intronic
1105295755 13:19086814-19086836 CACCCTGCCCAGCCTCCTGGAGG - Intergenic
1105582869 13:21717423-21717445 AACACTGCTCAGCCGCCTGGTGG - Intergenic
1105910736 13:24863840-24863862 CACACAACCCAGCCGACAGCAGG + Intronic
1106411517 13:29514457-29514479 CGCACAGCCCCGCCCCCCGGAGG - Exonic
1106422319 13:29594891-29594913 GACTCTGCCCGGCCGCCCGGAGG - Intronic
1107787479 13:43970432-43970454 CACAGTGCCCAGCGGCACGGAGG - Intergenic
1111232597 13:85363244-85363266 CACTCAGCGCCGCCGGCCGGCGG + Intergenic
1113906702 13:113822589-113822611 ACCACAGCCCAGCAGCCCAGGGG + Intronic
1113949813 13:114065710-114065732 CACACAGCCCTGGCTCCCAGAGG + Intronic
1114349029 14:21829573-21829595 CTCACAGCACAGCTGCCAGGAGG - Intergenic
1117334381 14:54744392-54744414 CACACCGCACAGCCTCCCTGTGG + Intronic
1121924854 14:97918199-97918221 CACTCAGCCCAGCTGACCAGAGG - Intergenic
1122748087 14:103911660-103911682 CACACAGCCCAACAACCCTGAGG + Intergenic
1122870413 14:104635706-104635728 CACACGGCCCAGCCCCTCAGAGG - Intergenic
1122870452 14:104635822-104635844 CACACAGCCCAGCCCCTTGAGGG - Intergenic
1124322501 15:28725686-28725708 CACCCACCTCAGCCTCCCGGGGG + Intronic
1124922168 15:34038435-34038457 CAGACAGCCCAGCCGGCCCACGG + Intronic
1127414992 15:58749363-58749385 CAGTCAGCCCAGCCGGCCAGCGG - Intronic
1127626655 15:60786692-60786714 CACACTGCCCATCTGCCCTGAGG + Intronic
1127818922 15:62638291-62638313 CACTCAGCTCAGTTGCCCGGAGG + Exonic
1128090795 15:64917375-64917397 CACCCTGCCCACCTGCCCGGAGG - Exonic
1128240871 15:66100190-66100212 CACAGAGCCCAGCCCACAGGAGG - Intronic
1129241775 15:74256220-74256242 CACAGAGCCCAGCCTCCTGAGGG - Intronic
1129844695 15:78762812-78762834 CTCACTGCCCTGCCGCCCCGAGG - Intronic
1130725173 15:86431915-86431937 TACACAGCCCAGTAGCCCTGGGG - Intronic
1131149520 15:90038064-90038086 CACCCAGCCCAGCCGACTGCGGG - Intronic
1132454942 16:17182-17204 CACATAGCCCAGGAGCCAGGGGG - Intronic
1132554833 16:567880-567902 CACACAGCCCGGGACCCCGGGGG + Exonic
1132587136 16:710491-710513 CACCCAGCCCATCTGCCCTGAGG - Intronic
1132631818 16:921447-921469 CACAAAGCCAAACCCCCCGGCGG + Intronic
1132724613 16:1333457-1333479 CTCACAGCCCCGCATCCCGGGGG + Intergenic
1132861024 16:2071867-2071889 CACGGACCCCAGCCGCACGGCGG - Exonic
1133304576 16:4801367-4801389 CACCCAGCCCTCCCTCCCGGCGG + Intronic
1136103348 16:28011289-28011311 CTCCCAGCCCAGCCGCCTGCAGG + Intronic
1139415168 16:66801905-66801927 CACACAGCACAGATGCCAGGTGG - Intergenic
1139958263 16:70703599-70703621 CACACAGCCCAGAGGCCCTGTGG + Intronic
1142418618 16:89956903-89956925 CTCAGAGCCCAGCAGCCTGGAGG + Intronic
1143106098 17:4531322-4531344 GACACAGCCCCGCCGCCCTCGGG + Intronic
1143110561 17:4550444-4550466 CCAACAGCCCAACAGCCCGGGGG + Intronic
1144729876 17:17520150-17520172 CACACTCCCCAGCGGCCAGGAGG - Intronic
1145863895 17:28227994-28228016 CACACAGCCCTGCAGCTCAGGGG - Intergenic
1147927058 17:43952782-43952804 CACACAGCCCTCCAGCCCAGGGG + Exonic
1148456616 17:47814654-47814676 GGCACTGCCCAGCTGCCCGGGGG - Intronic
1149626451 17:58083705-58083727 GACACAGGCCCGCCACCCGGGGG - Intronic
1149994643 17:61400149-61400171 CATCCGGCCCAGGCGCCCGGGGG - Exonic
1150338337 17:64345880-64345902 CACACAGCCCAGCGGCTCTACGG + Intronic
1152834421 17:82519979-82520001 GCCACGGCCCAGCCGCCCGGCGG - Exonic
1153688612 18:7568643-7568665 CATCCAGCCCGGCTGCCCGGGGG + Intronic
1156474206 18:37395328-37395350 CACACAGCCCAGCCCGCCGTGGG - Intronic
1158517978 18:58146605-58146627 CACACAGCACAGCTTCCAGGAGG - Intronic
1159684555 18:71401995-71402017 ATCACAGCCCAGCCGCCCCTTGG + Intergenic
1160579588 18:79875991-79876013 CACACTGCCCAGCAGCCCAGTGG + Intronic
1160941550 19:1622415-1622437 CCCACCGCCCACCCGCCCGCAGG - Exonic
1163485395 19:17582699-17582721 CACACAGCTCAGACGACCGAGGG - Exonic
1165810801 19:38610672-38610694 CACCATGCCCAGCCGACCGGTGG + Intronic
1167172409 19:47842166-47842188 CACACAGCCTAGACCCCCTGAGG + Exonic
1167374352 19:49103125-49103147 CACACAGCCCACCCCCTCCGAGG - Intronic
1167592829 19:50413720-50413742 CACACATCCCCACCGCCCGCAGG + Exonic
1167632299 19:50632593-50632615 CACCCAGGCCAGCCGCCAGGTGG + Exonic
925120727 2:1415811-1415833 CACCCAGCCCAGCCTCCTGCTGG + Intronic
925833901 2:7924112-7924134 AACACATCCCAGCCTCCCTGGGG - Intergenic
925998576 2:9311868-9311890 CACACAGCACACACGCCTGGTGG - Intronic
926636629 2:15187068-15187090 CAAGCAGCCCAGCAGCACGGAGG + Intronic
927518440 2:23685584-23685606 CATAGAGCCCAGCTGCCCTGTGG + Intronic
927945234 2:27131591-27131613 CAAAGAGCCCAGCCTCCGGGGGG + Intronic
928262367 2:29779306-29779328 CACTCAGCCCAGGCCCCAGGTGG - Intronic
929919058 2:46159622-46159644 CACACAGCCCAGGCGCTTGTGGG - Exonic
932619917 2:73259219-73259241 CAAAGAGCCCAGCAGCCCTGAGG - Exonic
933666754 2:84970970-84970992 CGCCGGGCCCAGCCGCCCGGAGG - Intergenic
934724142 2:96604277-96604299 CACACTGCAGAGCCGCCTGGTGG - Exonic
934730412 2:96652924-96652946 CACCAAGCCCAGCCTCCTGGAGG - Intergenic
937104052 2:119293979-119294001 TCCACAGCCCAGCTGCCCGCTGG - Intergenic
937227071 2:120376093-120376115 CACAGAGCCCAGAGGCCAGGTGG + Intergenic
937346627 2:121130096-121130118 GACACAGCCCAGCAGCCTGGAGG - Intergenic
937906824 2:127056539-127056561 CACACAGCTCAGACGCCTAGTGG - Intronic
938069232 2:128299806-128299828 AACACAGCCCATCTGCCAGGCGG + Intronic
948183539 2:236001455-236001477 CACTCTGCCCAGCCGCCAGAGGG - Intronic
1169984330 20:11425895-11425917 GACACAGCCCAGCAGCATGGTGG - Intergenic
1172118307 20:32584166-32584188 CACACCGCCCAGCCGGCCCGGGG + Intronic
1172619973 20:36312396-36312418 CACACAGTGCAGCCGCCCCCCGG + Intronic
1175110896 20:56647147-56647169 AACACAGCCCAGCCTCCAGGAGG - Intergenic
1175404115 20:58716066-58716088 CACACAGCACAGACTCCAGGTGG + Intronic
1175869768 20:62203206-62203228 CCCCCAGCCCAGCCTCCCCGTGG + Intronic
1176181429 20:63751635-63751657 CATAAAGCCCCGCCCCCCGGTGG + Intronic
1176181457 20:63751695-63751717 CATAAAGCCCCGCCCCCCGGTGG + Intronic
1176288750 21:5033401-5033423 CTCACAGCCCAGGCACCTGGAGG - Exonic
1179663427 21:42893066-42893088 CACAGCGCCCAGGCGCCCGCAGG + Intronic
1179868434 21:44230074-44230096 CTCACAGCCCAGGCACCTGGAGG + Exonic
1181954620 22:26579408-26579430 CCCACAGCCCTGGGGCCCGGTGG + Intronic
1185063196 22:48617764-48617786 CACACAGCCCAGCAGGCATGTGG - Intronic
1185248169 22:49784502-49784524 CGCACAGCACAGCCGGCCCGCGG + Intronic
949980276 3:9498542-9498564 CACACAGCACAGGCCCTCGGAGG + Exonic
951614092 3:24522363-24522385 CACACAGTCCAGCCTCCCACCGG - Intergenic
954116237 3:48468361-48468383 CACACAGCCTAGCTGCCCCCAGG - Exonic
954258469 3:49422271-49422293 CACTAAGCCCAGCCGCCCACAGG - Exonic
954611096 3:51944944-51944966 CCCACAGCCCTGCCACCCTGAGG - Intronic
954627753 3:52031977-52031999 CAGACCCCCCAGCCCCCCGGCGG + Intergenic
960996419 3:123343438-123343460 CACCCAGCTCTGCCGCCTGGTGG - Intronic
961450287 3:126999505-126999527 CACGCGCCCCAGCCGCCGGGAGG - Intronic
967925245 3:194640593-194640615 CATAAATCCCAGCCGCCTGGCGG + Intergenic
968477876 4:820884-820906 CTCACAGCCCAGCCCCACGGGGG + Intronic
968490094 4:885502-885524 CACCCACCCCAGCAGCCCTGCGG + Intronic
968925880 4:3547813-3547835 CACGGAGCCCAAGCGCCCGGTGG + Intergenic
969478637 4:7435162-7435184 GACACAGCCCAGGGGCCAGGAGG - Intronic
969604413 4:8195359-8195381 CACACAGCCCTGCCTGCCAGAGG - Intronic
972991941 4:44831169-44831191 CACATAGCCCAGCTGCCCTTAGG - Intergenic
975166708 4:71186575-71186597 CACAGAGCCCAAGCCCCCGGCGG + Intergenic
980930460 4:139178086-139178108 CCAACAGCCCGGCCGCGCGGCGG + Intergenic
981033694 4:140151074-140151096 CTCCCAGCCCAGCGGCCCCGGGG + Intronic
985758410 5:1732731-1732753 CACACAGCCCAGCTCCACAGTGG - Intergenic
985767501 5:1787634-1787656 CACACAGCCCTGCCCTCCCGGGG - Intergenic
986540489 5:8839836-8839858 CCGACGGCCCAGCCCCCCGGTGG - Intergenic
990895858 5:60699841-60699863 CCCAGAGCTCAGCCGGCCGGGGG - Intronic
997469756 5:134110633-134110655 CCAGCAGCCCAGCCTCCCGGCGG + Intergenic
999710626 5:154315329-154315351 CACACAGCCAAGCCCCGCAGGGG + Intronic
1002204489 5:177553706-177553728 CAGACAGCCAGGCTGCCCGGAGG - Intronic
1004320784 6:14630044-14630066 CACGGAGCCCAGCAGCACGGTGG - Intergenic
1004524294 6:16391847-16391869 CTCAAAGCCCAGCAGCCTGGAGG + Intronic
1005989942 6:30896535-30896557 CCCACACCTCAGCCTCCCGGAGG - Intronic
1006304935 6:33213233-33213255 CGCTCAGCCCCGCTGCCCGGCGG - Intergenic
1006717795 6:36131175-36131197 CTCTCAGCCCAGCTGCCCAGTGG + Intronic
1007761554 6:44136280-44136302 CACTCAGCCCAGCTTCCCGGGGG + Intronic
1017716896 6:157219087-157219109 CACACAGCACAGCCACGCTGGGG + Intergenic
1018190225 6:161304075-161304097 CACCCAGGCCAGCTGCCCGCTGG + Intergenic
1018662127 6:166098075-166098097 CACCCGGCGCAGCCGCCAGGGGG - Intergenic
1019017758 6:168892177-168892199 CACACAGCTCAGCCTCTAGGAGG + Intergenic
1019017773 6:168892256-168892278 CACACAGCTCAGCGTCCAGGAGG + Intergenic
1019017802 6:168892413-168892435 CACACAGCTCAGCATCCAGGAGG + Intergenic
1019017815 6:168892492-168892514 CACACAGCTCAGCATCCAGGAGG + Intergenic
1019017829 6:168892572-168892594 CACACAGCTCAGCGTCCAGGAGG + Intergenic
1019017844 6:168892652-168892674 CACACAGCTCAGCGTCCAGGAGG + Intergenic
1019347997 7:539882-539904 CACACAGGGCAGCCGCCTGGAGG - Intergenic
1019386452 7:759095-759117 CACAAAGCCCGGCCGGCCGCGGG - Intronic
1019431141 7:1000380-1000402 CACACACCTCAGCCCCCGGGGGG + Intronic
1019705680 7:2496147-2496169 CACACACAACAGCCGCCAGGCGG - Intergenic
1020204561 7:6104957-6104979 CACACAGCCCAGCCGCCCGGCGG - Exonic
1021877301 7:25060641-25060663 CACACAGCGCAGCCTCCTGGGGG - Intergenic
1022099817 7:27162249-27162271 CAAACAGGCCAGCTGCCTGGCGG - Intergenic
1022523120 7:31020494-31020516 GACACAGCCCAGGCCCCGGGTGG - Intergenic
1022563527 7:31373952-31373974 CAAATGGCCCAGCCTCCCGGAGG - Intergenic
1022721247 7:32943189-32943211 CCCAGAGCCCAGCCGCCGGTGGG + Intergenic
1023862620 7:44225368-44225390 CACCCACCCCAGCTGCACGGCGG + Intronic
1024059912 7:45690055-45690077 CACACAGCCCAGGAGGCAGGTGG + Intronic
1024249574 7:47496048-47496070 CACCCAGCCCAGAAGCCCAGAGG + Intronic
1024564295 7:50668751-50668773 CTCACAGCCCTGCCAACCGGTGG + Intronic
1029184563 7:98729409-98729431 CTCACAGCCCAGCCACAGGGCGG - Intergenic
1029258870 7:99287812-99287834 GACACCGCCCAGCTGCTCGGTGG - Intergenic
1036248416 8:7140709-7140731 CACACAACCCAGGAGCCCAGTGG - Intergenic
1036796832 8:11762220-11762242 CACACACCCCCGCCGCCCCCGGG - Exonic
1039884624 8:41647962-41647984 CACACAACGCAGCCCCCCAGAGG - Intronic
1040023414 8:42760887-42760909 CTTACAGCCCAGCAGCCTGGTGG + Intronic
1043516766 8:81001859-81001881 CAGACAGGCCAGACGCCTGGAGG - Intronic
1045173824 8:99698424-99698446 GACACAGCCCAGCCTCCTCGGGG + Intronic
1048155053 8:131939265-131939287 CACCCAGCCCAGCTGGACGGAGG + Intronic
1048919300 8:139213406-139213428 CACACAGCACAGCCCCTAGGAGG + Intergenic
1049393088 8:142382012-142382034 CACACAGGCCAGATGCTCGGTGG + Intronic
1049469457 8:142768951-142768973 CAAGCAGCCCAGCCCCCCAGGGG - Intronic
1049552722 8:143267846-143267868 CACAGAGCGCGTCCGCCCGGCGG - Intronic
1049586899 8:143436486-143436508 CACACGGCACAGCCACTCGGAGG - Intergenic
1053168814 9:35863784-35863806 CACACAGCCCACTGGCCCTGCGG + Intergenic
1053800762 9:41762991-41763013 CACAGAGCCCAAGCGCCCGGTGG + Intergenic
1054144433 9:61551844-61551866 CACGGAGCCCAAGCGCCCGGTGG - Intergenic
1054189193 9:61975143-61975165 CACGGAGCCCAAGCGCCCGGTGG + Intergenic
1054464121 9:65482803-65482825 CACGGAGCCCAAGCGCCCGGTGG - Intergenic
1054649328 9:67613474-67613496 CACGGAGCCCAAGCGCCCGGTGG - Intergenic
1055091089 9:72365216-72365238 CTCACAGCCCGGGCGCCGGGCGG - Intronic
1058355023 9:104074236-104074258 CACAAAGCCCAGCTACCCTGAGG + Intergenic
1059405827 9:114098072-114098094 CACCCAGCCCCGCCCCGCGGGGG + Intronic
1060822904 9:126671811-126671833 CCCACAGCCCAGGCCCCCAGCGG + Intronic
1060824869 9:126682214-126682236 CACAGAGCCCAGCCTCCCCAGGG + Intronic
1060836966 9:126763338-126763360 TGCTCAGCCCAGCCGCCCGCAGG - Intergenic
1061265943 9:129505219-129505241 AACACTGCCCACCCCCCCGGGGG + Intergenic
1061752785 9:132792474-132792496 CACCCATCCCATCTGCCCGGTGG - Intronic
1061876125 9:133545010-133545032 CCTACAGCCCAGCCTCCCAGCGG - Intronic
1061880322 9:133565716-133565738 CAGAGAACCCAGCCGCCCGGCGG - Intronic
1061942274 9:133890181-133890203 CACACAGCCGAGACTCCAGGGGG + Intronic
1061942856 9:133892316-133892338 CACAAAGCCCTGCAGCCCTGCGG - Intronic
1186837805 X:13455323-13455345 CACACAGGACAGCCCCACGGCGG + Intergenic
1195840638 X:109172362-109172384 CACACAGCCCACCACCCTGGAGG - Intergenic
1199760025 X:150898387-150898409 CGCACAGCCGGGCCGGCCGGTGG + Intronic
1200084950 X:153599367-153599389 GACACATACCAGCCGCCCCGTGG - Intronic