ID: 1020204562

View in Genome Browser
Species Human (GRCh38)
Location 7:6104960-6104982
Sequence CCGCACACAGCCCAGCCGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 247}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204562_1020204571 0 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204571 7:6104983-6105005 CGGCGGCGGCGGCGGCCGAGGGG 0: 3
1: 26
2: 188
3: 578
4: 1377
1020204562_1020204569 -2 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204569 7:6104981-6105003 GGCGGCGGCGGCGGCGGCCGAGG 0: 31
1: 1258
2: 1676
3: 3019
4: 6009
1020204562_1020204568 -8 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204568 7:6104975-6104997 GTGTGCGGCGGCGGCGGCGGCGG 0: 2
1: 16
2: 217
3: 2010
4: 3792
1020204562_1020204570 -1 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204562_1020204576 23 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204576 7:6105006-6105028 GATGGAGCGAGCGCCGAGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 111
1020204562_1020204572 1 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204572 7:6104984-6105006 GGCGGCGGCGGCGGCCGAGGGGG 0: 6
1: 58
2: 1373
3: 2218
4: 4345
1020204562_1020204575 22 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204575 7:6105005-6105027 GGATGGAGCGAGCGCCGAGCCGG 0: 1
1: 0
2: 0
3: 9
4: 110
1020204562_1020204573 5 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204573 7:6104988-6105010 GCGGCGGCGGCCGAGGGGGATGG 0: 1
1: 1
2: 13
3: 150
4: 1170
1020204562_1020204577 28 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204577 7:6105011-6105033 AGCGAGCGCCGAGCCGGGTCAGG 0: 1
1: 0
2: 0
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204562 Original CRISPR CCGCACACAGCCCAGCCGCC CGG (reversed) Exonic
900652105 1:3734785-3734807 CCGCTGACAGCACAGTCGCCTGG + Exonic
900706242 1:4082122-4082144 CCGCACCCAGCCCAACAGGCTGG - Intergenic
901448572 1:9322861-9322883 CCGCACCCACCCCACCCGCCCGG + Intronic
902617722 1:17632956-17632978 CCAGGCACAGCCCAGCAGCCGGG - Intronic
902923505 1:19680869-19680891 CCCCTCAGAGGCCAGCCGCCGGG - Intergenic
903413713 1:23167880-23167902 CCGGCCCCCGCCCAGCCGCCCGG - Intronic
903770956 1:25764035-25764057 CCTCACTCAGCCCAGGGGCCTGG - Intronic
903972667 1:27129270-27129292 CCACACAGAGCCCAGCCAGCTGG - Intronic
904916966 1:33977205-33977227 CCCCACCCAGCCCTGCTGCCAGG - Intronic
907069221 1:51519060-51519082 CCTCACACACACCGGCCGCCCGG + Intronic
907260033 1:53211165-53211187 CCGCACTGAGACCATCCGCCCGG + Exonic
908602778 1:65759147-65759169 CAGCCCACATCCCAGCCTCCAGG + Intergenic
909534758 1:76724132-76724154 GCTCCCACAGCCCAGCAGCCTGG + Intergenic
910846678 1:91610987-91611009 GCGCACACAGCCAGGCTGCCTGG + Intergenic
911055212 1:93702698-93702720 CCGCACACCGCCCAGTGGCATGG + Intronic
912691625 1:111809101-111809123 CTCAACACAGCCCAGCAGCCAGG - Intronic
924102571 1:240619883-240619905 CCGCACACATTCCTGCCGTCTGG + Intergenic
924219252 1:241855856-241855878 CCGCACTCAGAGCAGCCGGCCGG - Intronic
1064167863 10:13001789-13001811 CCGCCCACGCCCCAGCCGCAGGG - Intronic
1065183047 10:23145916-23145938 CCGCTCCCCACCCAGCCGCCCGG - Intergenic
1065183118 10:23146394-23146416 CCGCACACAGCTGCTCCGCCCGG + Intergenic
1067735016 10:48844042-48844064 CCACTCACAGCCGGGCCGCCTGG + Intronic
1069861147 10:71472495-71472517 CCTCACTCAGCCCAGCTGCCAGG + Intronic
1070685145 10:78475044-78475066 TGACACACAGCCCAGCCACCTGG - Intergenic
1070811044 10:79298310-79298332 CCGCACTCATCCCAGGGGCCTGG - Intronic
1073177793 10:101566860-101566882 CCGCAGGCAGGCCAGACGCCCGG - Intergenic
1073320819 10:102615438-102615460 CAGCACCCAGCTCAGCCTCCAGG + Intronic
1076439877 10:130473983-130474005 CAGCACACAGCCCAGCACCGAGG - Intergenic
1076723472 10:132402848-132402870 TAGCACACAGCACAGCCCCCAGG - Intronic
1076807710 10:132867271-132867293 ACACACACAGGCCGGCCGCCTGG + Intronic
1077015352 11:396836-396858 CGGCCTACAGCCCAGCCTCCTGG + Exonic
1077330632 11:1982504-1982526 CCGCCCACAGCCCAGGAGCTGGG - Intronic
1077352591 11:2099791-2099813 GTGCACCCAGCCCAGCAGCCTGG - Intergenic
1077426755 11:2483730-2483752 CCTCACACAGCCCTGCCACAGGG - Intronic
1080384822 11:31805125-31805147 CGGCACAAAGCCCTGCCGGCCGG + Intronic
1080728032 11:34916666-34916688 CGGATCACAGCCCAGCCTCCAGG - Exonic
1081550600 11:44108258-44108280 ACTCATACAGCCCAGCCCCCAGG + Intronic
1081872365 11:46389311-46389333 CCCGGCTCAGCCCAGCCGCCAGG - Intergenic
1083477158 11:62921973-62921995 GCGCACACAGCCCAGCATGCGGG - Intergenic
1083667414 11:64283490-64283512 CCCCACACAGCCCTGCTGTCTGG + Intronic
1083715847 11:64576512-64576534 ACACACACAGCCCAGCTGACAGG - Intergenic
1083800174 11:65041879-65041901 CCACGCTCTGCCCAGCCGCCAGG - Intronic
1084529174 11:69717046-69717068 CCCCCCACATCCCAGCCGCTTGG - Intergenic
1085621127 11:78038614-78038636 TCTCACACAGCCCAGACACCTGG + Intronic
1087486406 11:98763688-98763710 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1088764575 11:112962902-112962924 CGACACACAGCCCCTCCGCCCGG - Intronic
1089244752 11:117110730-117110752 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1089618715 11:119709963-119709985 CCGCAGAGAGCTCAGCCCCCAGG + Intronic
1202813610 11_KI270721v1_random:37683-37705 CCGCCCACAGCCCAGGAGCTGGG - Intergenic
1091374645 12:17617-17639 CAGCACATAGCCCAGGAGCCAGG - Intergenic
1091396746 12:157849-157871 CCGGAAACTCCCCAGCCGCCTGG - Intronic
1091498277 12:991160-991182 CCGCCCCCAGCCCCGCCGCGGGG - Intronic
1093181518 12:15972408-15972430 CTGCACACATCCCAGCCAGCTGG + Intronic
1094569336 12:31628136-31628158 CTCCACACTGCCCCGCCGCCAGG + Intergenic
1095414812 12:41965234-41965256 CTGCACACAGCCCTTCAGCCAGG + Intergenic
1096841000 12:54379172-54379194 CCGCACAGCCCCGAGCCGCCCGG - Intronic
1097017941 12:56000421-56000443 CCGCACACGGAGCAGCCGGCTGG - Intronic
1101146543 12:101846047-101846069 CTGCACCCAGCCCAGCCGCAGGG + Intergenic
1101409493 12:104457080-104457102 CCGCTCGCACCCCAGCCGCCCGG + Exonic
1103738508 12:123076198-123076220 CTGCACACCGCCCAGATGCCAGG + Intronic
1104282307 12:127389281-127389303 CCACACACAGAAAAGCCGCCCGG + Intergenic
1104311066 12:127654783-127654805 CCACACACAGCACAGAGGCCTGG + Intergenic
1104311331 12:127656510-127656532 CCACACACAGCACAGAAGCCTGG - Intergenic
1104676438 12:130715009-130715031 CTGCTCAGAGCCCAGCAGCCTGG + Intronic
1107454023 13:40537650-40537672 CTCCCCACAGCCCCGCCGCCAGG + Intergenic
1113382277 13:109814579-109814601 CCACACACAGGACAGCCTCCAGG + Intergenic
1113758618 13:112832243-112832265 CCGCACACAGGGCAGCCTCGGGG + Intronic
1115769916 14:36657890-36657912 CCGCACACTGACCTGCGGCCTGG - Intronic
1116121382 14:40725173-40725195 GCGCACACTGCCCAGGTGCCAGG - Intergenic
1120891361 14:89494446-89494468 AAGCAGACAGCCCAGCCGGCAGG - Intronic
1120970830 14:90205633-90205655 CCACCCACAGCCCAGCCCCTGGG + Intergenic
1122549290 14:102541075-102541097 GCGCAGCCAGCCCAGCCTCCAGG - Intergenic
1122972771 14:105159098-105159120 CCACACCCAGCCCAGCCTCCAGG + Intronic
1122983288 14:105201126-105201148 CCCCACACAGCCCACCCTCCAGG - Intergenic
1123010486 14:105347317-105347339 CAGCACACATCCCTGCCCCCAGG - Intronic
1124019158 15:25903805-25903827 CCCCACACAGCCCAGGTTCCAGG + Intergenic
1126088975 15:45034917-45034939 CCGCACTCAGAGCAGCCGGCCGG + Intronic
1128457336 15:67839015-67839037 CCGCACAGCTCCCAGCCTCCAGG - Intergenic
1128525729 15:68410981-68411003 CCGCACACTCCCCACCAGCCTGG - Intronic
1128699419 15:69793551-69793573 CCCCAGCCAACCCAGCCGCCGGG - Intergenic
1129339006 15:74872941-74872963 CCTAGCACAGCCCAGCCTCCGGG + Intronic
1129690504 15:77710706-77710728 CCTCACACAGCCCACCTGCGAGG + Intronic
1129876217 15:78977335-78977357 GCCCACACAGCCCAGCCTCAAGG - Intronic
1130232227 15:82105724-82105746 GCCCACACAGGCCAGCCTCCTGG + Intergenic
1131827427 15:96332214-96332236 CCGCACACGCCACAGACGCCCGG + Exonic
1132454945 16:17185-17207 CAGCACATAGCCCAGGAGCCAGG - Intronic
1132714213 16:1282685-1282707 GCCCACACAGCCCAGCCTCCCGG - Intergenic
1132714228 16:1282756-1282778 CCACACACAGCCCAGCCTCCCGG - Intergenic
1132760990 16:1508637-1508659 AGGCACACAGCCCAGCCCCACGG - Intronic
1133038342 16:3046765-3046787 CCACACACATCCCAGCCCTCCGG + Exonic
1135113467 16:19708064-19708086 CACCCCACAGCCCAGCAGCCGGG + Intronic
1135295811 16:21278352-21278374 CTGGTCACAGCCCAGCCTCCGGG + Intronic
1135735844 16:24931239-24931261 CAGCACACGGGCCAGCCTCCAGG - Exonic
1137645104 16:50066582-50066604 CCGCCCGCAGCCCAGACGCGGGG - Intronic
1137668615 16:50266453-50266475 CAGCCCACAGCCCAGCCTCTCGG - Intronic
1138179164 16:54930745-54930767 CCGCAGCCAACCCGGCCGCCAGG - Intergenic
1138522165 16:57577400-57577422 CCCCACACAGTGCAGCCTCCAGG + Intronic
1139847847 16:69933212-69933234 CCACAAACAGCCCAGCAGCTGGG + Intronic
1140454981 16:75099745-75099767 CAGCACAAAACCCAGGCGCCTGG - Intronic
1141869274 16:86773497-86773519 TGGCACTCAGCCCAGCAGCCTGG - Intergenic
1143375238 17:6463359-6463381 CAGCACACAGCCCAGCCACAGGG + Intronic
1143771118 17:9169572-9169594 CCGCACCCAGCCAATCCTCCAGG - Intronic
1144340266 17:14304122-14304144 CCGCTCGCAGCGCAGCCCCCGGG - Intronic
1144950616 17:18991725-18991747 CAGCTCCCAGCCCAGCAGCCTGG + Intronic
1147599620 17:41737869-41737891 CCTCCCACAGCCCAGCTTCCTGG + Intergenic
1148078855 17:44956247-44956269 ACCCACACAGCCCTGCCCCCTGG + Intergenic
1148763645 17:50022874-50022896 CCTCCTCCAGCCCAGCCGCCTGG + Intergenic
1148765848 17:50037787-50037809 CCTCCCCCAGCCCACCCGCCTGG - Intergenic
1148987292 17:51634099-51634121 CTGCAAACAGTCCAGCCACCTGG - Intronic
1149879406 17:60273265-60273287 CCGCACCCAGCCCAGATGCTAGG + Intronic
1150488302 17:65559155-65559177 CTGCACACAGCCTAGCGGCTGGG - Intronic
1150618219 17:66788858-66788880 AGGCCCACAGCCCAGCCGCTTGG - Exonic
1150786765 17:68169635-68169657 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1151951569 17:77357025-77357047 CCCCCCACAGCCCAGCCACCAGG - Intronic
1152799726 17:82325236-82325258 CCTGCCACAGCGCAGCCGCCCGG - Intronic
1153651893 18:7248313-7248335 CTGCACAGAGCACAGCCGCGCGG + Intergenic
1154485817 18:14870850-14870872 CCTGACACAGCCCACCTGCCTGG + Intergenic
1155170137 18:23260951-23260973 CTGCACACAGCCCAGCGGAAGGG + Intronic
1155437253 18:25826321-25826343 CCCTACACAGCCCAGGGGCCTGG + Intergenic
1156149448 18:34224615-34224637 TCGGACGCAGCCCAGGCGCCGGG - Intronic
1158319455 18:56247379-56247401 CTGCCCACATCCCAGCCTCCAGG + Intergenic
1158517979 18:58146608-58146630 CTGCACACAGCACAGCTTCCAGG - Intronic
1160733933 19:653288-653310 CCGCACACAGCCCGTTCCCCTGG + Intronic
1161245393 19:3249056-3249078 CACCACACAGCCCAGCTGGCGGG + Intronic
1161894342 19:7069306-7069328 CCACACTCAGCCCTGCCTCCAGG + Intergenic
1162100441 19:8335560-8335582 GCGCACGTAGCCCAGGCGCCTGG - Exonic
1163408218 19:17136742-17136764 CCGCCCACCGACCAGCCCCCTGG + Intronic
1163602501 19:18257482-18257504 ACGCACACAGCCCACCCGTGTGG - Exonic
1164693551 19:30227609-30227631 GCGCACACGACCCAGCCCCCAGG - Intergenic
1164982954 19:32627986-32628008 CCCCACCCAGCCCATCAGCCAGG + Intronic
1166061504 19:40328482-40328504 CAGCACACCCCCCAGGCGCCCGG - Exonic
1166754077 19:45179743-45179765 CCGCCGCCAGCCCCGCCGCCTGG - Exonic
1166850702 19:45759253-45759275 CCGCTCACAGCCCACTCCCCTGG - Intronic
1166963306 19:46513063-46513085 CCGCACCCAGCCCAGACAGCAGG + Intronic
1167593586 19:50416701-50416723 CCGCACAGTGCTCAGCCACCAGG + Exonic
1167765652 19:51480512-51480534 CCGCCCAGTGCCCAGCAGCCTGG + Exonic
1168247012 19:55117504-55117526 CCGCCCCCGGGCCAGCCGCCGGG + Exonic
1168287944 19:55343646-55343668 TCGCCCACAGCCCTGCCCCCTGG + Intronic
925142125 2:1557811-1557833 CAGGACTCAGCACAGCCGCCTGG + Intergenic
927558219 2:24050343-24050365 CCGCTCACAGCCCGGCCCGCAGG - Intronic
931461994 2:62457382-62457404 CCGCACCCAGCCCTTCCTCCAGG - Intergenic
936152143 2:110027762-110027784 CCGCACAAGGCCCAGAGGCCCGG + Intergenic
936192535 2:110343651-110343673 CCGCACAAGGCCCAGAGGCCCGG - Intergenic
936521037 2:113212376-113212398 CCGCCTACTGCCCAGACGCCCGG - Intergenic
937087534 2:119181366-119181388 CCTGACCCAGCCCAGCCTCCTGG + Intergenic
937346628 2:121130099-121130121 CTAGACACAGCCCAGCAGCCTGG - Intergenic
937908614 2:127064688-127064710 CCAGGCACAGCCCAGCTGCCTGG - Intronic
937997957 2:127709359-127709381 CAGGAGACAGCCCAGCCCCCCGG + Intronic
940009251 2:149037889-149037911 CCTCCCACATCCCAGCTGCCTGG + Intergenic
941749679 2:169121159-169121181 CGGCACACAGCCCAGGGTCCTGG + Intergenic
942491084 2:176490414-176490436 CCGCACAAGGCCCAGTCCCCAGG - Intergenic
946177169 2:217928936-217928958 CCACACACAGAGCAGCTGCCAGG + Intronic
948816152 2:240511376-240511398 CCGCATCCACCCCAGCCGCTGGG + Intronic
949004260 2:241636726-241636748 CCGCCCCCACCCCGGCCGCCTGG - Intronic
1169556668 20:6758332-6758354 CCACACAAAGCCTAGCAGCCTGG - Intergenic
1169723066 20:8700197-8700219 CCGCACACTGCCCATCCGCCAGG + Intronic
1171150357 20:22822153-22822175 CTGCAGACAGCCCAGGAGCCCGG + Intergenic
1172445790 20:34992858-34992880 CCGCACCCAGCCAACCCCCCAGG + Intronic
1173383234 20:42565191-42565213 CAGCTCACAGCCCACCCACCTGG + Intronic
1174204335 20:48828005-48828027 CCGCCCCCGGCCCAGCCGCCCGG - Intergenic
1175036546 20:56005469-56005491 CCCCACACAGCCCTGGGGCCTGG + Exonic
1175110897 20:56647150-56647172 TAGAACACAGCCCAGCCTCCAGG - Intergenic
1175404130 20:58716159-58716181 CCTCACACAGCGCAGGCTCCAGG - Intronic
1175678736 20:60968958-60968980 TAGCACAAAGCCCAGCCCCCGGG - Intergenic
1176795512 21:13368619-13368641 CCTGACACAGCCCACCTGCCTGG - Intergenic
1179797611 21:43794505-43794527 CAGAGCACAGCCCAGCAGCCCGG - Intronic
1179887773 21:44321764-44321786 CCGCATTCATGCCAGCCGCCGGG - Exonic
1183489106 22:38107366-38107388 CCCAACACAGCCCAGCCCCCCGG - Intronic
1184095659 22:42314925-42314947 GCCCTCACAGCCCAGCCTCCTGG + Intronic
1184408543 22:44313617-44313639 CTGGACACAGCCCAGGGGCCTGG + Intergenic
1184721128 22:46314124-46314146 CCGCACACAGCACGCCCTCCGGG - Intronic
1185246593 22:49776253-49776275 CCGAGCACAGCCCAGCTCCCAGG + Intronic
1185365980 22:50436913-50436935 CCCCACCCAGCCCAGCGCCCAGG - Intronic
949919693 3:8991006-8991028 CAGCACACAGCTCAGCAGCAGGG + Intronic
952764873 3:36945017-36945039 CTGCACACCGCCCGGACGCCGGG - Exonic
954305191 3:49721937-49721959 CCCCACCCAGCCCAGCCCACAGG + Exonic
955360613 3:58270994-58271016 CAGCATACACCCCAGCCACCTGG - Exonic
957804925 3:85134138-85134160 CCGCACTCAGAGCAGCCGGCCGG - Intronic
960664485 3:120095616-120095638 CCGCGCCCCGCCCAGCCGCGGGG + Intergenic
960846971 3:122013062-122013084 CCCCACTCAGCACAGCAGCCTGG - Intronic
960996420 3:123343441-123343463 CCACACCCAGCTCTGCCGCCTGG - Intronic
961450288 3:126999508-126999530 CGGCACGCGCCCCAGCCGCCGGG - Intronic
965245258 3:166258745-166258767 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
966191034 3:177272005-177272027 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
966973682 3:185067394-185067416 CCGTACACAGCCCTGCCCTCAGG + Intergenic
968674803 4:1871596-1871618 CCTCCCACAGCCCGGCCTCCCGG - Intronic
968934151 4:3601248-3601270 CCTCCCACAGCCCAGCGGTCAGG + Intergenic
969344763 4:6563734-6563756 CCGCCCATGGCCCAGCAGCCGGG - Intergenic
969373980 4:6750966-6750988 CCCCGCCCAGCCCAGCCCCCTGG - Intergenic
972790848 4:42369724-42369746 CCGCACTCGTCCCAGCCGGCTGG + Intergenic
974484805 4:62492173-62492195 CCGCACTCAGAGCAGCCGGCGGG - Intergenic
977906467 4:102483210-102483232 CCGCACTCAGAACAGCCGGCCGG + Intergenic
978419167 4:108511752-108511774 AATCACATAGCCCAGCCGCCTGG + Intergenic
982436056 4:155384079-155384101 CTGCACTCAGCCCAGCCCCAGGG + Intergenic
983152902 4:164307533-164307555 CCTCTCACACCCCAGCCCCCTGG + Intronic
991657780 5:68920952-68920974 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
992671960 5:79069848-79069870 TCGCTCGCAGCCCAGCGGCCAGG - Intronic
999144042 5:149381015-149381037 CAGAACACAGCCAGGCCGCCCGG - Intronic
999303861 5:150507597-150507619 CCCCACCCAGCTCAGCTGCCAGG - Intronic
999304446 5:150510553-150510575 CCCCACACAGCCCCACCCCCAGG + Intronic
1002415608 5:179119461-179119483 CAGGACACAGCCCAGGCCCCAGG + Intronic
1002724610 5:181286349-181286371 CCTGACACAGCCCACCTGCCTGG + Intergenic
1003072874 6:2958500-2958522 CCTCTCAGAACCCAGCCGCCAGG + Intronic
1003107781 6:3228598-3228620 CCGCCGACAGCCCCGCCCCCGGG - Intronic
1003159680 6:3624451-3624473 CTGCCCACAGCCCAGCCGCATGG - Intergenic
1006423013 6:33947312-33947334 CCACTCACAGCCCAGCTGCCAGG - Intergenic
1013173471 6:107658092-107658114 CAGCACACTCTCCAGCCGCCAGG - Intronic
1015244701 6:131063092-131063114 CCCCACACTGACCAGTCGCCCGG + Intronic
1018064255 6:160114777-160114799 CCGCACTCAGAGCAGCCGGCCGG - Intergenic
1018680316 6:166258941-166258963 GCAGACACAGCCCAGCCACCTGG + Intergenic
1019154826 6:170031930-170031952 GGGCACACAGGCCAGGCGCCCGG - Intergenic
1019347999 7:539885-539907 CACCACACAGGGCAGCCGCCTGG - Intergenic
1019359077 7:595485-595507 CCGCACACACCCCACCTGCCAGG - Intronic
1019442210 7:1053120-1053142 CCCCAGACAGCCCGGCAGCCAGG + Intronic
1019482444 7:1273139-1273161 CCCCACACCGCCCATCCGGCCGG - Intergenic
1019711481 7:2520017-2520039 CCGCCCCCAGCCCGGGCGCCGGG - Exonic
1020056534 7:5121390-5121412 CCGCACTCCGCGCAGCCGCAGGG + Intergenic
1020204562 7:6104960-6104982 CCGCACACAGCCCAGCCGCCCGG - Exonic
1020225365 7:6275491-6275513 CCGCACCCGGCCCAGTCCCCAGG + Intergenic
1021877305 7:25060644-25060666 CACCACACAGCGCAGCCTCCTGG - Intergenic
1024834029 7:53495105-53495127 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1025004542 7:55344079-55344101 CCTCCCAGAGCTCAGCCGCCTGG + Intergenic
1026178306 7:68016907-68016929 CAGCACACAGCCCAGGAGGCCGG - Intergenic
1026335881 7:69393911-69393933 CCGCACTCAGAGCAGCCGGCCGG + Intergenic
1029641687 7:101824618-101824640 CCGCCCTCAGCCTAGCCTCCGGG + Intronic
1030983355 7:116211190-116211212 CCCCAGACAGCCCAGCCGGAAGG - Intronic
1032130738 7:129225288-129225310 CCGCTCTCAGCCCCGCCGCCGGG + Exonic
1033299694 7:140175979-140176001 CCGCACACACCCGGGTCGCCGGG - Intronic
1034533415 7:151711992-151712014 CGAGACACAGCCCAGCCACCTGG - Intronic
1034551455 7:151823143-151823165 CCCCTCTCAGCACAGCCGCCTGG + Intronic
1035199108 7:157248746-157248768 CTGCACTCAGCTCAGACGCCAGG - Intronic
1036054015 8:5230182-5230204 CCGCGCCCAGCCAAGCCACCTGG + Intergenic
1036682730 8:10887407-10887429 CCCTAGACAGCCCAGCCGCTGGG + Intergenic
1037996068 8:23353090-23353112 CGACACACAGCCCAGCCACAAGG + Intronic
1046288886 8:112132775-112132797 CCGCACTCAGAGCAGCCGGCAGG + Intergenic
1046965974 8:120166058-120166080 CTGCACACAGCCCACCTGACTGG - Intronic
1047956903 8:129983598-129983620 CCCCACACAGCCCCACCGGCAGG + Intronic
1048808496 8:138263295-138263317 CCGGACACAGCCAACCCTCCAGG + Intronic
1049220448 8:141426472-141426494 CCACACACAGCCCAGGTGCCAGG - Intronic
1049721125 8:144116042-144116064 CCCCACCCACCCCAGCCCCCGGG + Intronic
1049988466 9:972320-972342 CTGAACAAAGCCCAGCCGCGGGG - Intergenic
1053885975 9:42645423-42645445 CCGCAGCCAGGCGAGCCGCCAGG - Intergenic
1053886747 9:42649725-42649747 CCTGACACAGCCCACCCGCCTGG + Intergenic
1054224995 9:62452872-62452894 CCGCAGCCAGGCGAGCCGCCAGG - Intergenic
1054225766 9:62457175-62457197 CCTGACACAGCCCACCCGCCTGG + Intergenic
1059124029 9:111666763-111666785 CTGCTCACAGCCAAGCCACCCGG - Intronic
1059393889 9:114018278-114018300 CCGACCACAGCCCTGCTGCCTGG - Intronic
1060882224 9:127125273-127125295 CCGCACACACCCCTGCCTCAGGG - Intronic
1060932607 9:127498192-127498214 CTGCAGTCAGCCCAGCCCCCTGG - Intronic
1061778136 9:132979617-132979639 CCACACACTGCCCAGGCTCCAGG + Intronic
1062426035 9:136506680-136506702 CCCCACACGCCCCACCCGCCTGG + Intronic
1062478461 9:136740996-136741018 CCGCCCACAGCCCTGACCCCTGG + Intronic
1062639937 9:137514039-137514061 CCGCCCACAGCCCAGCCACAGGG - Intronic
1062639998 9:137514235-137514257 CCACCCACAGCCCAGCCACAGGG - Intronic
1062640013 9:137514284-137514306 CCGCCCACAGCCCGGCCACAGGG - Intronic
1062640060 9:137514431-137514453 CCACCCACAGCCCAGCCACAGGG - Intronic
1062640087 9:137514518-137514540 CCGCCCGCAGCCCAGCCACAGGG - Intronic
1062640104 9:137514567-137514589 CCGCCCACAGCCCGGCCACAGGG - Intronic
1062640122 9:137514616-137514638 CCGCCCGCAGCCCAGCCACAGGG - Intronic
1062640151 9:137514714-137514736 CCACCCACAGCCCAGCCACAGGG - Intronic
1062640181 9:137514812-137514834 CCGCCCGCAGCCCAGCCACAGGG - Intronic
1062640209 9:137514910-137514932 CCGCCCACAGCCCAGCCACAGGG - Intronic
1186182470 X:6986421-6986443 CCCCACACAGCCCAGGGGCTCGG + Intergenic
1192549340 X:72041647-72041669 CCGCACACAGTCCAGACCCTGGG + Intergenic
1194876934 X:99201090-99201112 CTGCACACAGCACAGGGGCCTGG - Intergenic
1195840641 X:109172365-109172387 CCCCACACAGCCCACCACCCTGG - Intergenic
1198530803 X:137548561-137548583 CCGCTTACAGCCCAGCTTCCGGG - Intergenic
1198664330 X:139004303-139004325 CCGCACTCAGAACAGCCGGCCGG - Intronic
1201469081 Y:14314503-14314525 CCGCACACAGCCCTGGTTCCTGG - Intergenic
1201949884 Y:19551614-19551636 CCGCTCACAGCTCCGCCTCCTGG - Intergenic