ID: 1020204567

View in Genome Browser
Species Human (GRCh38)
Location 7:6104972-6104994
Sequence GCTGTGTGCGGCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1233
Summary {0: 1, 1: 1, 2: 13, 3: 169, 4: 1049}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204560_1020204567 -7 Left 1020204560 7:6104956-6104978 CCCGCCGGGCGGCTGGGCTGTGT 0: 1
1: 0
2: 3
3: 9
4: 178
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204561_1020204567 -8 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204558_1020204567 -5 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204552_1020204567 17 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204559_1020204567 -6 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049
1020204551_1020204567 18 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG 0: 1
1: 1
2: 13
3: 169
4: 1049

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204567 Original CRISPR GCTGTGTGCGGCGGCGGCGG CGG Exonic
900115937 1:1027954-1027976 GCTGTGGGCCGGGGCGGCCGTGG - Intronic
900144483 1:1151870-1151892 GCTGTGAGCGGAGGCCCCGGGGG - Intergenic
900300497 1:1974466-1974488 GCTGTGTCCGTTGGCTGCGGTGG + Intronic
900414670 1:2529499-2529521 CTGGTGCGCGGCGGCGGCGGCGG + Exonic
900429989 1:2596843-2596865 TCTGGGTGCTGCTGCGGCGGGGG + Intronic
900540243 1:3199118-3199140 GCTGTGCGGGGTGGCGGCAGAGG + Intronic
900703609 1:4062673-4062695 GCTGTGTCCAGCGGCCGCTGTGG - Intergenic
900787104 1:4655820-4655842 GCTGGGCGCGGCGGGCGCGGGGG + Intronic
901022176 1:6261040-6261062 GCGAAGCGCGGCGGCGGCGGCGG - Intergenic
901057402 1:6455101-6455123 GCCGTGGGCGGCGGCGGCGCTGG - Intronic
901057623 1:6456012-6456034 GCGGCGGGCGGGGGCGGCGGCGG - Intronic
901086215 1:6613797-6613819 GCAGGGGGCGGCGGCGGCGGCGG - Exonic
901086216 1:6613800-6613822 GCTGCAGGGGGCGGCGGCGGCGG - Exonic
901628977 1:10639034-10639056 GCTGCCCGAGGCGGCGGCGGAGG - Exonic
901641344 1:10694606-10694628 GCACCGGGCGGCGGCGGCGGCGG - Intronic
901704231 1:11061208-11061230 ACTGTGGGAGGCGGAGGCGGAGG + Intergenic
901743820 1:11359552-11359574 CATGTGTGTGGGGGCGGCGGTGG - Intergenic
902323569 1:15684304-15684326 GCTGTGCGCCGCGGCGGCGGCGG - Intergenic
902476957 1:16693378-16693400 GCCGTGGGCGGCGGCGGCGCTGG + Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
903115635 1:21176591-21176613 GCCGGCGGCGGCGGCGGCGGAGG - Intronic
903115636 1:21176594-21176616 GCTGCCGGCGGCGGCGGCGGCGG - Intronic
903115637 1:21176597-21176619 GCTGCTGCCGGCGGCGGCGGCGG - Intronic
903129053 1:21266468-21266490 GCTGTGAGCGGTGGCAGTGGTGG - Intronic
903263420 1:22143116-22143138 CCGGGATGCGGCGGCGGCGGCGG + Intronic
903324740 1:22563449-22563471 GCCCGGGGCGGCGGCGGCGGCGG + Intergenic
903413961 1:23168738-23168760 GGTCCGTGAGGCGGCGGCGGCGG - Intronic
903829117 1:26164409-26164431 GCAGGCGGCGGCGGCGGCGGAGG - Intergenic
903907390 1:26696449-26696471 TCCGAGGGCGGCGGCGGCGGCGG - Exonic
904719958 1:32500485-32500507 GTAGCGGGCGGCGGCGGCGGCGG + Intronic
904720063 1:32500827-32500849 CCTGGCGGCGGCGGCGGCGGCGG + Intronic
904724850 1:32539580-32539602 GCTGCACGCGGCGCCGGCGGAGG + Intronic
904822731 1:33256170-33256192 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
904822949 1:33256820-33256842 GCCCAGAGCGGCGGCGGCGGCGG + Intronic
905137070 1:35808165-35808187 CCCGTTGGCGGCGGCGGCGGCGG + Exonic
905137072 1:35808168-35808190 GTTGGCGGCGGCGGCGGCGGCGG + Exonic
905137119 1:35808332-35808354 GCGTTACGCGGCGGCGGCGGCGG + Exonic
905179266 1:36156369-36156391 GGTCTCAGCGGCGGCGGCGGCGG - Exonic
905414384 1:37794393-37794415 GCGGTGCGGGGCGGCGGCGGCGG - Exonic
905553134 1:38859721-38859743 GGTGGTGGCGGCGGCGGCGGAGG - Exonic
905863861 1:41366448-41366470 GCTGGGCACGGCGGCGGGGGAGG - Intronic
906027024 1:42682606-42682628 GCTGAGGGCGGGGGCGGCGGGGG - Exonic
906205099 1:43982385-43982407 TCTGTGGTCGGCGGGGGCGGGGG - Intronic
906480968 1:46198513-46198535 GCTTAGGGCGGCGGCGGCGGCGG + Intronic
906636976 1:47416394-47416416 CCTGCGAGCGGCGACGGCGGCGG - Exonic
906637013 1:47416488-47416510 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
906640507 1:47438220-47438242 GTGGTGGGCGGCGGCAGCGGCGG + Exonic
906640652 1:47438814-47438836 TGTGGGTGCGGCGGCGGCAGGGG - Exonic
907341545 1:53739188-53739210 GCAGGACGCGGCGGCGGCGGCGG - Intergenic
908132169 1:61083755-61083777 GGTGGCGGCGGCGGCGGCGGGGG - Intronic
908132172 1:61083758-61083780 GGTGGTGGCGGCGGCGGCGGCGG - Intronic
908242410 1:62198518-62198540 GCGGGGTGGGGCGGCGGCGGGGG - Intronic
909433573 1:75616128-75616150 GGTGGCTGCTGCGGCGGCGGCGG + Intergenic
909643100 1:77888591-77888613 GCTGGAGACGGCGGCGGCGGCGG + Intronic
911017239 1:93346176-93346198 GCTGCTGGCGGCGGCGGCAGCGG + Exonic
914730391 1:150364662-150364684 TCTGGCGGCGGCGGCGGCGGCGG - Intronic
915165362 1:153945331-153945353 GGTGTGTGTGGTGGCGGTGGCGG + Intronic
915200114 1:154220995-154221017 GGCGTTGGCGGCGGCGGCGGCGG + Intronic
915246350 1:154558633-154558655 GCGGACCGCGGCGGCGGCGGCGG - Exonic
915325321 1:155078911-155078933 TCGGGGGGCGGCGGCGGCGGCGG + Exonic
915393153 1:155562419-155562441 GGCGGGAGCGGCGGCGGCGGCGG + Exonic
916507967 1:165445157-165445179 GGTGACGGCGGCGGCGGCGGCGG - Exonic
916922680 1:169485721-169485743 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
917755390 1:178093775-178093797 GGTGGCGGCGGCGGCGGCGGCGG - Intergenic
917869597 1:179229635-179229657 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
919465698 1:197920002-197920024 GCCCTGTGCGCCGGCTGCGGGGG + Exonic
919712283 1:200739614-200739636 CCCGGGAGCGGCGGCGGCGGCGG + Exonic
919926349 1:202193850-202193872 GCTCTATTGGGCGGCGGCGGCGG - Intergenic
920309968 1:205043242-205043264 TCCGGGTGCGGCGGCGGCCGCGG - Exonic
920528608 1:206685654-206685676 GCCGAGTGCGGCGCGGGCGGCGG + Intronic
920705011 1:208244302-208244324 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
920912737 1:210233215-210233237 GCTGGGCGCGGAGGCGGCGCGGG + Intronic
921138620 1:212285277-212285299 TCTTGGTGCGGCGGCGGGGGAGG - Intergenic
921472612 1:215567377-215567399 GCAGGCTGCGGCGGCGTCGGTGG + Exonic
921945692 1:220884507-220884529 GGTGGGAGCAGCGGCGGCGGCGG + Exonic
922215378 1:223516046-223516068 GCAGTGTGGGGAGGTGGCGGGGG - Intergenic
922315080 1:224434682-224434704 AGTGGCTGCGGCGGCGGCGGCGG + Intronic
922504437 1:226118475-226118497 GCTGTGGGTGGCGGGGGTGGTGG + Intergenic
923016244 1:230128609-230128631 TGTGTGTGTGGCGGGGGCGGGGG + Intronic
923141456 1:231163729-231163751 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
923141457 1:231163732-231163754 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
923592216 1:235328776-235328798 ACTGTGAGCGGCAGTGGCGGCGG + Exonic
923744306 1:236686412-236686434 GCCGGGGGCGGTGGCGGCGGGGG + Intergenic
923777782 1:236995512-236995534 GCTGGGTGTGGTGGCGGCTGTGG + Intergenic
923783008 1:237042460-237042482 GCGGAGCTCGGCGGCGGCGGCGG - Exonic
924052423 1:240092263-240092285 GGAGGGGGCGGCGGCGGCGGCGG + Exonic
924415165 1:243850290-243850312 GCGGGAGGCGGCGGCGGCGGCGG + Intronic
924624110 1:245686009-245686031 GCTGTGGGCGGGTGCCGCGGCGG - Exonic
1062774713 10:135516-135538 GCCGGGCGCGGCGGCGGCGGCGG + Intronic
1062831413 10:608359-608381 GCTGTGTGTGGGGGGGGCTGTGG - Intronic
1062874128 10:931594-931616 GCTGGCGGCGGCGGCGGCGGCGG + Exonic
1063930751 10:11026372-11026394 GGTGTGTGTGGCGGGGGAGGCGG - Intronic
1063995089 10:11611521-11611543 GCGCGGCGCGGCGGCGGCGGCGG + Intronic
1064185478 10:13158478-13158500 GCTGGTGGCGGAGGCGGCGGGGG - Intergenic
1064185499 10:13158545-13158567 GGAGAGGGCGGCGGCGGCGGTGG - Intergenic
1064205703 10:13321778-13321800 GCTGTGGGTGGCGGCCTCGGCGG + Intronic
1064208929 10:13347666-13347688 TTTTTGCGCGGCGGCGGCGGCGG - Intronic
1064208969 10:13347774-13347796 GCCCCGCGCGGCGGCGGCGGCGG + Intronic
1064209073 10:13348105-13348127 GCCGCGCCCGGCGGCGGCGGCGG + Exonic
1064230921 10:13528881-13528903 CCGGGGCGCGGCGGCGGCGGCGG + Intronic
1064274261 10:13891976-13891998 GCGGCGGGCGGTGGCGGCGGCGG - Intronic
1064443183 10:15371308-15371330 GCGGGCAGCGGCGGCGGCGGCGG - Intergenic
1064981871 10:21173844-21173866 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1065069025 10:22003346-22003368 GGCGTCCGCGGCGGCGGCGGCGG + Exonic
1065100362 10:22325560-22325582 GGTGGGTGCGGCGACGCCGGGGG - Intronic
1065140473 10:22714454-22714476 GCTGAGCGCGCCGGCGGCGGCGG - Exonic
1065342978 10:24723686-24723708 TCGGAGCGCGGCGGCGGCGGCGG - Intergenic
1065520571 10:26567285-26567307 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065712871 10:28533651-28533673 GCGGCGGGGGGCGGCGGCGGGGG + Intronic
1066065620 10:31759504-31759526 GGTGTGTGGGGCGGGGGGGGCGG - Intergenic
1066429330 10:35336850-35336872 GCCATGGGCGGCGGCGGCGGCGG - Intronic
1066464214 10:35639478-35639500 CCGGGGGGCGGCGGCGGCGGGGG - Exonic
1067669617 10:48306951-48306973 GCGGTGGGCGGGGGCGGCGCGGG + Intronic
1068866770 10:61903162-61903184 GGTGTGTGGGACGGGGGCGGGGG + Intronic
1068954906 10:62813705-62813727 GTTATAGGCGGCGGCGGCGGCGG + Exonic
1069930603 10:71878985-71879007 GCCATGTGCGGTGGCTGCGGAGG - Intergenic
1070032616 10:72692194-72692216 TCTCGGGGCGGCGGCGGCGGGGG + Exonic
1070328334 10:75401885-75401907 CCTGGCAGCGGCGGCGGCGGCGG - Exonic
1070570645 10:77637745-77637767 GCGCTCCGCGGCGGCGGCGGCGG - Intronic
1071086824 10:81875236-81875258 GCGGGCTCCGGCGGCGGCGGCGG - Intergenic
1071306459 10:84303157-84303179 TGTGTGTGTGGCGGCGGGGGGGG + Intergenic
1071507320 10:86240579-86240601 GGTGGGTGCGGCGGGGGCGGGGG + Intronic
1072263243 10:93702529-93702551 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1072619067 10:97067902-97067924 GCGGTGTGCGGCGGGGCAGGGGG - Intronic
1072710650 10:97713850-97713872 CCTGGGCGCGGTGGCGGCGGCGG - Exonic
1072719462 10:97771812-97771834 CATGCGGGCGGCGGCGGCGGGGG - Exonic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1072915543 10:99535515-99535537 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1073030237 10:100519862-100519884 GCTGTGGACGGCGGCTGCGGAGG + Intronic
1073099528 10:100999562-100999584 GCTCGACGCGGCGGCGGCGGTGG - Exonic
1073290112 10:102409242-102409264 GGAGTGCGCGGCGGCGGCGGCGG + Intronic
1073491486 10:103855727-103855749 GCTGTGGGCGCAGGAGGCGGAGG + Intergenic
1074138060 10:110644584-110644606 GGTGGCTGGGGCGGCGGCGGCGG - Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1075032096 10:119030301-119030323 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
1075032097 10:119030304-119030326 GGTGGTGGCGGCGGCGGCGGCGG - Exonic
1075370038 10:121928001-121928023 GCATTGTGGGGTGGCGGCGGCGG - Exonic
1075697483 10:124447619-124447641 GCGGGGGGCGGCGGCGGCGGCGG - Exonic
1075697484 10:124447622-124447644 GCGGCGGGGGGCGGCGGCGGCGG - Exonic
1075768926 10:124917198-124917220 GCGCTTGGCGGCGGCGGCGGCGG - Intergenic
1076372496 10:129964393-129964415 GGCGAGCGCGGCGGCGGCGGCGG - Intergenic
1076554144 10:131311315-131311337 GGGGTGCGCGGCGGCGGCGGCGG + Exonic
1076554242 10:131311649-131311671 GCTGACGGCGGCGGCGGGGGCGG + Exonic
1076554279 10:131311794-131311816 GCCGGGTCCGGGGGCGGCGGCGG - Intergenic
1076750084 10:132538051-132538073 GGGCTGGGCGGCGGCGGCGGCGG - Exonic
1076750085 10:132538054-132538076 GCTGGGCTGGGCGGCGGCGGCGG - Exonic
1077043671 11:535299-535321 GGCGTAAGCGGCGGCGGCGGCGG - Intronic
1077074680 11:694990-695012 CCTGGCTGAGGCGGCGGCGGTGG - Exonic
1077085377 11:747448-747470 GGGGTCTGCGGCGGCGGCGGCGG - Exonic
1077098434 11:810012-810034 GGCGTCTGCGGCGGAGGCGGCGG - Exonic
1077151769 11:1076008-1076030 GCTGTGTGCTGGGGCGGAAGGGG - Intergenic
1077463814 11:2724043-2724065 GCTGTGTGCAGAGGTGGTGGGGG - Intronic
1078210293 11:9265050-9265072 GCCATGAGTGGCGGCGGCGGCGG - Exonic
1079177248 11:18153686-18153708 GGTGTGTGGGGCGACGGCAGTGG - Intronic
1079179182 11:18173646-18173668 GGTGTGTGGGGCGGCGGCAGCGG - Exonic
1079266077 11:18934373-18934395 GGTGTGTGGGGCGGTGGCAGCGG + Exonic
1079296724 11:19241322-19241344 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
1080503769 11:32893162-32893184 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1080503806 11:32893259-32893281 GCTGCTGGCGGCGGCGGCGGCGG - Exonic
1081686980 11:45049625-45049647 GCTGGGAGCGGGGGCTGCGGTGG + Intergenic
1081700037 11:45146985-45147007 GCTGGGGGCGGGGGCGGCCGGGG + Intronic
1081807901 11:45900159-45900181 TCTGCGGGCGGCGGCGGCGCGGG + Exonic
1082003741 11:47408644-47408666 TCACCGTGCGGCGGCGGCGGCGG - Exonic
1082045260 11:47720831-47720853 GCCGGGGGCGGTGGCGGCGGCGG + Intronic
1082787514 11:57324912-57324934 GGTGACGGCGGCGGCGGCGGCGG - Intronic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083171093 11:60924499-60924521 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1083329614 11:61891466-61891488 GCAGCGGGCGGCGGCGGAGGCGG - Exonic
1083430681 11:62612472-62612494 GCTCCGAGCGGCGGCGGCGGAGG + Exonic
1083572572 11:63768392-63768414 GCTTTGTTCGGCGGCGGAGAGGG + Intronic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1083945047 11:65919010-65919032 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1084028230 11:66466370-66466392 GGGGTGTGCGGCAGCGGTGGAGG - Intronic
1084072387 11:66744814-66744836 GGAGGGGGCGGCGGCGGCGGCGG + Intronic
1084174312 11:67415693-67415715 GCGGGATGCAGCGGCGGCGGCGG - Intronic
1084284162 11:68120939-68120961 TCTGCGGGCGGCTGCGGCGGCGG + Exonic
1084564673 11:69922145-69922167 GCTGTCTGCGGGGTCGGCGTGGG + Intergenic
1084946639 11:72642270-72642292 CATGGCTGCGGCGGCGGCGGCGG + Exonic
1085165815 11:74398449-74398471 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1085331808 11:75658394-75658416 GCTGTCTGGGGCGGGGGGGGTGG - Intronic
1086375417 11:86195197-86195219 GGTGGGTGCGGCTGGGGCGGGGG - Intergenic
1088256496 11:107908391-107908413 GGCGTCTGCGGCGGCGGCGGCGG - Intronic
1088764352 11:112961915-112961937 ACTTTGTGCGCCCGCGGCGGTGG + Intronic
1089046330 11:115504343-115504365 CCAGTGTGCGGCGGCAGCGGCGG - Exonic
1089432652 11:118436558-118436580 ACCGGGGGCGGCGGCGGCGGGGG + Exonic
1089543667 11:119206288-119206310 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
1089582833 11:119492210-119492232 GCTGTGTGACGGGGCGGTGGGGG + Intergenic
1089616061 11:119695482-119695504 GCTGTGTGCTGGGACGTCGGGGG - Intronic
1090408222 11:126490221-126490243 TGTGTGTGTGGCGGGGGCGGGGG + Intronic
1090699179 11:129279241-129279263 GCGCTCGGCGGCGGCGGCGGCGG - Intronic
1090699180 11:129279244-129279266 GCGGCGCTCGGCGGCGGCGGCGG - Intronic
1090832880 11:130431290-130431312 GGTGGTGGCGGCGGCGGCGGTGG - Intergenic
1091225743 11:133955902-133955924 GCTGGGGGCGGCGGCGGGGGAGG - Intronic
1091581932 12:1795626-1795648 GATGTGTGCGGTGGGGGCGGGGG - Intronic
1091759459 12:3077385-3077407 GCTGGCGGCGGCGGCGGCGGCGG + Exonic
1092898785 12:13039266-13039288 GCTTTTTGGGGGGGCGGCGGGGG + Intergenic
1093464988 12:19439889-19439911 GGTGGGGGCGGCGGAGGCGGCGG + Exonic
1093547927 12:20369554-20369576 GCAGTGTAAGGAGGCGGCGGCGG + Exonic
1093894680 12:24562727-24562749 GGGGGGTGCGGCGGGGGCGGGGG + Intergenic
1094611774 12:32001656-32001678 GCTGTGTGGGCCGGGTGCGGTGG - Intergenic
1095752801 12:45729683-45729705 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
1096241374 12:49961926-49961948 GGTGGATGCGGCGGGGGCGGGGG - Exonic
1096255068 12:50057787-50057809 GCGGCGTGCCGCGGCGGCCGCGG + Exonic
1096309126 12:50504996-50505018 GCTCATGGCGGCGGCGGCGGCGG + Intronic
1096700583 12:53380395-53380417 GCGGGAGGCGGCGGCGGCGGCGG + Intronic
1096784405 12:54009027-54009049 GCGGGCGGCGGCGGCGGCGGCGG - Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096863834 12:54549599-54549621 GCAGCGCGCGGCGGCGGCGGCGG + Exonic
1097057426 12:56258298-56258320 GCTCCCGGCGGCGGCGGCGGCGG + Exonic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097166981 12:57091254-57091276 GCTGTGTGAGGCGGGTGAGGAGG + Exonic
1097195019 12:57238399-57238421 GATGTGTGTGGGGGGGGCGGGGG + Intronic
1097267568 12:57755083-57755105 GCTCCTTCCGGCGGCGGCGGCGG - Exonic
1097648167 12:62260721-62260743 CCGGGGAGCGGCGGCGGCGGCGG + Intronic
1097850267 12:64404475-64404497 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
1097990092 12:65825009-65825031 GCCGGTGGCGGCGGCGGCGGTGG - Exonic
1097990093 12:65825012-65825034 GCTGCCGGTGGCGGCGGCGGCGG - Exonic
1098105958 12:67069303-67069325 GCTCCGGGCGGCGGCGGCGGCGG + Intergenic
1098320571 12:69239605-69239627 GCAGGAGGCGGCGGCGGCGGCGG + Exonic
1098550369 12:71755133-71755155 GCTGCGGCCGGCGGCGGCGGCGG + Exonic
1098550370 12:71755136-71755158 GCGGCCGGCGGCGGCGGCGGCGG + Exonic
1098781615 12:74694218-74694240 GCTGGGTGCGGTGGCGGTGGCGG - Intergenic
1099365208 12:81759190-81759212 TGTGTGTGCTGTGGCGGCGGGGG - Intronic
1100328837 12:93567120-93567142 GCTGTGTGTGGTGGTGGTGGTGG + Intergenic
1100329750 12:93571872-93571894 GCCTGGTGCGGAGGCGGCGGCGG + Exonic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1100423410 12:94459802-94459824 TCCGAGGGCGGCGGCGGCGGCGG + Exonic
1100844553 12:98645172-98645194 GGAGTGCGCGGCGGCAGCGGTGG + Exonic
1100963077 12:99984756-99984778 GAGGAGCGCGGCGGCGGCGGCGG + Intergenic
1101131816 12:101697824-101697846 GCTGCGCTCGGTGGCGGCGGCGG + Exonic
1101144754 12:101830724-101830746 GCTCGCTGAGGCGGCGGCGGCGG - Exonic
1101773824 12:107775760-107775782 GCGCTGTGCGGCGGGCGCGGGGG - Exonic
1101813626 12:108129298-108129320 GCTGGTGGCGGCGGCGGCAGCGG + Intergenic
1101935357 12:109052614-109052636 CCTCGGTCCGGCGGCGGCGGCGG + Exonic
1102197153 12:111033965-111033987 CCCGTTGGCGGCGGCGGCGGCGG + Intergenic
1102197155 12:111033968-111033990 GTTGGCGGCGGCGGCGGCGGCGG + Intergenic
1102371025 12:112382344-112382366 CCTGAGGGCGGCGGCGGCGGCGG - Intronic
1102933805 12:116881073-116881095 GCTGTGCGCGGCCGCGCAGGTGG - Exonic
1103005406 12:117416689-117416711 GTTGTGGGGGGCGGCGGGGGAGG - Intronic
1103309100 12:119989978-119990000 GATGAGGGCGGCGGCGGCGGCGG - Exonic
1103363682 12:120368397-120368419 GCGGTGGGGGGCGGCGGCAGTGG - Intronic
1103400640 12:120640898-120640920 GCTGAAGGCGGCGGCGGCGGCGG + Exonic
1103779529 12:123389458-123389480 GGTGGAGGCGGCGGCGGCGGCGG + Exonic
1103800349 12:123533715-123533737 CGAGTGGGCGGCGGCGGCGGCGG + Exonic
1103899138 12:124294594-124294616 CCTGTGGGTGGGGGCGGCGGGGG - Intronic
1103954260 12:124567607-124567629 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1104444716 12:128823871-128823893 GCGGCGGGCGGCGGCGGCCGCGG - Exonic
1105030212 12:132877464-132877486 GCTGTGTGCCACGGCTGAGGAGG - Intronic
1105217514 13:18297718-18297740 GGTGGAGGCGGCGGCGGCGGCGG + Intergenic
1105472069 13:20703735-20703757 GCTCGGGGCGGCGGCGGCGGCGG + Intronic
1106242001 13:27920265-27920287 AACGGGTGCGGCGGCGGCGGCGG - Exonic
1106269366 13:28138717-28138739 GCTGGCGGCGGCGGTGGCGGTGG + Exonic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1106478029 13:30114803-30114825 GCGGGAGGCGGCGGCGGCGGCGG + Intergenic
1106590070 13:31091425-31091447 GCCGGGAGCGGGGGCGGCGGGGG - Intergenic
1106652158 13:31703347-31703369 GCTGTGAGCGGCGGGGGAGGTGG + Intergenic
1106735734 13:32586522-32586544 ATTGGATGCGGCGGCGGCGGCGG + Exonic
1107058545 13:36131368-36131390 GAGGAGGGCGGCGGCGGCGGCGG + Intergenic
1107133464 13:36920142-36920164 GCAGGGCCCGGCGGCGGCGGCGG + Exonic
1107770896 13:43786824-43786846 TCTGTCTGCTGCAGCGGCGGCGG - Exonic
1107851499 13:44576828-44576850 CCGGGGCGCGGCGGCGGCGGTGG + Intronic
1108013826 13:46052444-46052466 CCTCGGAGCGGCGGCGGCGGTGG - Intronic
1108373409 13:49792508-49792530 GCTGCGCGCGGCTCCGGCGGCGG + Exonic
1108689268 13:52847297-52847319 CCCGAGTGCAGCGGCGGCGGCGG + Exonic
1109061972 13:57631824-57631846 GCTGGCTGAGGCAGCGGCGGCGG - Exonic
1109284857 13:60397595-60397617 CCTGGAGGCGGCGGCGGCGGCGG + Intronic
1110318198 13:74134285-74134307 GCCGAGGGCGGGGGCGGCGGCGG + Intergenic
1110558513 13:76886259-76886281 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
1110965489 13:81689968-81689990 GCAGTCCGCGGCGGCGGAGGAGG - Intergenic
1111035490 13:82667358-82667380 GCTGGGTGCGGTGGCGGCGCAGG - Intergenic
1111397043 13:87677531-87677553 AGCGTGTACGGCGGCGGCGGCGG + Exonic
1111764746 13:92514139-92514161 TGTGTGTGGGGCGGGGGCGGGGG - Intronic
1111951315 13:94711546-94711568 GCTGCCCGCGGCGGCGGCGGCGG + Exonic
1111951329 13:94711606-94711628 GACGCGTGCGGCGGCAGCGGCGG + Exonic
1112216249 13:97434091-97434113 GCTGGGGGTAGCGGCGGCGGCGG + Intergenic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112216367 13:97434435-97434457 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1112505032 13:99970402-99970424 GCCGGGGGCGGTGGCGGCGGCGG + Exonic
1112505036 13:99970411-99970433 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1112560257 13:100506382-100506404 GGTGGGGGCGGGGGCGGCGGGGG + Intronic
1113541863 13:111115426-111115448 GATGGGCGAGGCGGCGGCGGCGG + Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1114270678 14:21098333-21098355 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1114270679 14:21098336-21098358 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1114519004 14:23321469-23321491 GATGGCGGCGGCGGCGGCGGCGG + Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115235792 14:31207665-31207687 GCTGCGGGCGACGGCGGCGGCGG + Intronic
1115557140 14:34552850-34552872 CCTGTGTGCGGGGGCGGGGAGGG - Intergenic
1115851783 14:37595136-37595158 GGCGTGCGCGGCGGCGGCGGCGG + Intronic
1116456960 14:45131342-45131364 GCTGTGTGGGCCGGGCGCGGTGG + Intronic
1116657003 14:47665817-47665839 GCGGGGTGGGGCGGGGGCGGGGG - Intronic
1116835656 14:49767565-49767587 GCTGGCGGCGGCAGCGGCGGCGG + Intergenic
1116887053 14:50231670-50231692 GCGGTGAGCAGCGGCGGCGGCGG + Intergenic
1116916740 14:50532578-50532600 ACGTGGTGCGGCGGCGGCGGCGG - Exonic
1117875780 14:60249218-60249240 GCTAGAGGCGGCGGCGGCGGCGG + Intronic
1117875928 14:60249722-60249744 GGCCTGCGCGGCGGCGGCGGCGG + Intronic
1117920791 14:60723763-60723785 GGTCTGCGCGGCGGCGGCGGCGG + Exonic
1118142662 14:63101620-63101642 GGTGTGTGGGGTGGGGGCGGAGG + Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1118801249 14:69191780-69191802 GCCGTGTGCGACGGGGGCGAGGG - Exonic
1119410311 14:74426155-74426177 GGGCTGCGCGGCGGCGGCGGCGG - Intergenic
1120167901 14:81220349-81220371 GCGGGAAGCGGCGGCGGCGGCGG + Intronic
1120168028 14:81220936-81220958 TCTCTCGGCGGCGGCGGCGGCGG - Intronic
1120809887 14:88792657-88792679 CCTGTGGGCTGAGGCGGCGGCGG - Exonic
1120953046 14:90060489-90060511 GCTGTGTGCGCGGGCGGGGGCGG + Intergenic
1121279388 14:92688187-92688209 GGTGGTGGCGGCGGCGGCGGCGG + Exonic
1121283864 14:92719282-92719304 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
1121368089 14:93332870-93332892 GCTGGTGGCGGCGGCGGCGGAGG - Exonic
1121368112 14:93332939-93332961 GGAGAGGGCGGCGGCGGCGGCGG - Exonic
1122067103 14:99181490-99181512 GCTGTGTGCCGAGGCGGGGCTGG - Intronic
1122143375 14:99675235-99675257 GCGGCGGGCGGCGGCGGGGGCGG + Exonic
1122211655 14:100177890-100177912 ACTGTCCGCGGCGGCGGGGGTGG + Intergenic
1122620965 14:103057478-103057500 CTAGTCTGCGGCGGCGGCGGCGG - Intergenic
1122635334 14:103127078-103127100 GCTGGCGGCGGCGGCGGCGGCGG + Exonic
1122647991 14:103207558-103207580 GCAGTGCGCGGCGTGGGCGGAGG + Intergenic
1122658586 14:103279292-103279314 GCAGTGCGCGGCGTGGGCGGAGG + Intergenic
1122672854 14:103385437-103385459 CCGGGGTGCGGCGGCGGCAGCGG + Intronic
1122856780 14:104563795-104563817 GCTGTGTGTGGGGGAGGAGGGGG + Intronic
1122986219 14:105212822-105212844 GCTGTGTGGGGAGGCGGTAGGGG + Intronic
1123024848 14:105419775-105419797 GCGGTGGGCGGCGGCGCCCGAGG + Intronic
1123630672 15:22258012-22258034 CCGGTGAGCGGCAGCGGCGGCGG - Intergenic
1123898061 15:24848229-24848251 GGTGGGGGCGGGGGCGGCGGCGG + Intronic
1124469275 15:29968798-29968820 TGTGTCTGCGGCGGCGGCGGAGG - Intronic
1125677570 15:41511172-41511194 ACTGCGGGCGGAGGCGGCGGCGG - Exonic
1126034956 15:44537194-44537216 GATGGCGGCGGCGGCGGCGGCGG + Exonic
1127144083 15:56007190-56007212 GATCCGGGCGGCGGCGGCGGCGG + Intergenic
1127165767 15:56243791-56243813 GGAGCGAGCGGCGGCGGCGGCGG - Intergenic
1128344126 15:66842814-66842836 GCAGGGGGCGGCGGCGGCGCCGG + Intergenic
1128454839 15:67826732-67826754 GCTGGCGGCGGTGGCGGCGGTGG + Intronic
1128506805 15:68278278-68278300 CCTGGGCGCGGCGGCGGCGACGG + Exonic
1128529156 15:68432090-68432112 CCGGTGTGCAGCGGCGGCGGGGG + Exonic
1128547742 15:68579207-68579229 GCGGCGTGCGGGGGCGGCGGCGG - Exonic
1128743304 15:70097458-70097480 GCTTGCAGCGGCGGCGGCGGCGG - Exonic
1128841475 15:70854246-70854268 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
1128841476 15:70854249-70854271 GGTGGTGGCGGCGGCGGCGGCGG - Intronic
1128972247 15:72117988-72118010 ACTGCGAGAGGCGGCGGCGGAGG - Exonic
1129016722 15:72474871-72474893 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1129048030 15:72754294-72754316 GGTGTGTGGGGCGGCGGGGGCGG - Intronic
1129189177 15:73927564-73927586 TCGGGGGGCGGCGGCGGCGGCGG - Exonic
1129311800 15:74718055-74718077 GCTTTGTGCAGCGGCGGCCGGGG - Intergenic
1129339242 15:74874025-74874047 CCTGTGGGGGGCGGGGGCGGGGG - Intergenic
1129676038 15:77632807-77632829 GCAGGCGGCGGCGGCGGCGGTGG - Intronic
1129780146 15:78264619-78264641 GCTACAAGCGGCGGCGGCGGCGG + Intronic
1130040667 15:80403780-80403802 GCTGTGTGCGGCGGTGGCCTTGG + Intergenic
1130319712 15:82830902-82830924 GGTGGGGGCGGCGGTGGCGGCGG - Exonic
1130656438 15:85794784-85794806 GGTCTCTGAGGCGGCGGCGGCGG - Exonic
1131091793 15:89629264-89629286 GCTGTGAGTGGCAGGGGCGGTGG + Intronic
1131259301 15:90880302-90880324 GCTGTGAGAGGCGGCGGCGCTGG - Intronic
1131416739 15:92266526-92266548 AGTATGTGGGGCGGCGGCGGAGG + Intergenic
1131827013 15:96330396-96330418 CCTCTCGGCGGCGGCGGCGGCGG + Intronic
1132055556 15:98648537-98648559 CCAGTGTGTGGCAGCGGCGGCGG + Intergenic
1132368658 15:101277423-101277445 GGGCTGGGCGGCGGCGGCGGCGG - Exonic
1132398293 15:101489769-101489791 GGTGTTGGCGGCGGCGGTGGCGG - Exonic
1132462233 16:61351-61373 GCTGGGGGCGGGGCCGGCGGGGG - Intronic
1132604650 16:788622-788644 GCAGTGCGCGACGGCGGCGGCGG + Exonic
1132641992 16:982181-982203 CCGGTGCGCGGCGGCGGCGGCGG + Exonic
1132799942 16:1747063-1747085 GCTGGGTGTGGCGGCCGCCGAGG - Exonic
1132877957 16:2148663-2148685 CCTGGCGGCGGCGGCGGCGGCGG - Exonic
1132885098 16:2179030-2179052 GGGGGGCGCGGCGGCGGCGGCGG + Exonic
1133021604 16:2969365-2969387 GCTCGCGGCGGCGGCGGCGGCGG - Exonic
1133051603 16:3120271-3120293 GCTGGGGGCGGCGGCGGCGGGGG + Exonic
1133156454 16:3880141-3880163 GCGGCCGGCGGCGGCGGCGGCGG - Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1133212872 16:4272863-4272885 GATGCTGGCGGCGGCGGCGGCGG + Exonic
1133311134 16:4847523-4847545 GCGGTCTGAGGCGGCGGCGGCGG + Intronic
1134419322 16:14071335-14071357 GGCGGGAGCGGCGGCGGCGGCGG + Intronic
1134656109 16:15949614-15949636 GCTGGCGGCGGCGGCGGCGGCGG - Exonic
1135517715 16:23149325-23149347 GCGGGATGCGGCGGCGGCCGTGG - Intergenic
1135537011 16:23302378-23302400 GCTGTCGGCGGTGGCGGAGGCGG - Exonic
1135572200 16:23557767-23557789 GGTGAGTGCGGCGGGGGTGGCGG + Exonic
1135712497 16:24729680-24729702 GGTGTCGGCGGCGGCGGCGGCGG + Intronic
1135821884 16:25692384-25692406 GCTCGCGGCGGCGGCGGCGGCGG - Exonic
1136003539 16:27313774-27313796 GGACTGTCCGGCGGCGGCGGCGG + Intronic
1136110891 16:28063200-28063222 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1136585981 16:31185079-31185101 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1136627692 16:31472125-31472147 GCCGTGTCCGGTGGGGGCGGGGG - Exonic
1137617789 16:49857304-49857326 GGTGGCGGCGGCGGCGGCGGCGG + Intronic
1137678508 16:50317045-50317067 GCTAAGTGCGGGGGTGGCGGTGG + Exonic
1137988645 16:53131066-53131088 GGTGGCAGCGGCGGCGGCGGCGG - Intronic
1137988647 16:53131072-53131094 GCGGTGGGTGGCAGCGGCGGCGG - Intronic
1138105319 16:54284693-54284715 TCTGTGAGCGGCGGCGGCGGCGG + Exonic
1138360748 16:56425438-56425460 GCCCGGCGCGGCGGCGGCGGCGG - Exonic
1138450774 16:57092566-57092588 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1139466140 16:67155128-67155150 GCAGGTGGCGGCGGCGGCGGCGG + Exonic
1139631845 16:68236017-68236039 GGAGGGGGCGGCGGCGGCGGCGG + Exonic
1139806002 16:69565971-69565993 CCTGTCAGCGGCGGCGGCGGTGG + Intronic
1139917801 16:70438997-70439019 GCTTTCTGCGCGGGCGGCGGCGG - Intronic
1140187411 16:72787699-72787721 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
1140223032 16:73057985-73058007 GCCGGGAGCGGCGGGGGCGGGGG + Intronic
1140223217 16:73058565-73058587 GCTGCTGGCGACGGCGGCGGCGG + Intronic
1140223218 16:73058568-73058590 GCTGGCGACGGCGGCGGCGGCGG + Intronic
1140223243 16:73058664-73058686 GCGGGGGTCGGCGGCGGCGGAGG + Intronic
1140223249 16:73058691-73058713 GCTGCTGGCGGCGGCGGCGGCGG + Intronic
1140223250 16:73058694-73058716 GCTGGCGGCGGCGGCGGCGGCGG + Intronic
1140723130 16:77788755-77788777 GCGGAGGGCGGCGGCGGCGACGG + Exonic
1140927587 16:79599211-79599233 GCTGGGGGCGGCGGCGGCGGCGG - Exonic
1140927600 16:79599244-79599266 GCTGGGGGCGCGGGCGGCGGTGG - Exonic
1141292021 16:82727082-82727104 GATGAGGGCGGCGGCGGTGGTGG + Intronic
1141582726 16:85011325-85011347 CCGGCCTGCGGCGGCGGCGGCGG + Exonic
1141682598 16:85553295-85553317 GCCGGCAGCGGCGGCGGCGGCGG - Intergenic
1141683024 16:85555106-85555128 GCTGAAGGCGGCGGCGGCGGCGG - Intergenic
1141698787 16:85633015-85633037 GGTGACAGCGGCGGCGGCGGCGG - Intronic
1141951618 16:87343576-87343598 GGTGTGTGCAGCGGCGGGGCTGG - Exonic
1141957616 16:87383318-87383340 GCTGGGAGTGGCGGGGGCGGTGG - Intronic
1141972393 16:87492569-87492591 CCGGTGCGCGGCGGCGGCGGCGG + Intergenic
1142144938 16:88489045-88489067 GATGTGGGGGGCGGCAGCGGTGG - Exonic
1142205245 16:88779814-88779836 GCTGAGTGCCGCGGTGGCCGGGG - Intronic
1142656689 17:1399521-1399543 CCCGTGTGGGGCGGCGGCCGTGG - Intronic
1142757857 17:2026008-2026030 CCTGGGTGGGGTGGCGGCGGGGG + Intergenic
1142799707 17:2337542-2337564 AGTGGCTGCGGCGGCGGCGGCGG + Exonic
1142811801 17:2399023-2399045 GCCGTGTGCCGCCGCCGCGGCGG - Intronic
1142990022 17:3724156-3724178 GCCCGGTGAGGCGGCGGCGGAGG + Exonic
1143094240 17:4468567-4468589 GCAGGGGGCGGTGGCGGCGGGGG + Intronic
1143223653 17:5282371-5282393 TCTCTGGGCGGCGGCGGCGGCGG + Exonic
1143494969 17:7307637-7307659 CCCGTGTGCAGCAGCGGCGGCGG + Intronic
1143514732 17:7414011-7414033 GCTGTGTGCGGGGGTGCTGGGGG + Intronic
1143527224 17:7479606-7479628 GATGTCAGCGGCGGCGGCGGCGG - Intronic
1143527260 17:7479692-7479714 CCTCTCGGCGGCGGCGGCGGCGG - Intronic
1143539764 17:7562014-7562036 GCTGGTGGCGGCGGTGGCGGAGG + Exonic
1143590773 17:7885029-7885051 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1143590885 17:7885326-7885348 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
1144021165 17:11241068-11241090 GCTCCGGGCGGCGGCGGCGGCGG - Intergenic
1144565056 17:16353150-16353172 GGAGTCGGCGGCGGCGGCGGCGG + Exonic
1144724542 17:17495261-17495283 GCCGGCAGCGGCGGCGGCGGCGG - Exonic
1144840501 17:18183087-18183109 GCTCCGGGCGGCGGCGGCAGCGG + Intronic
1145327700 17:21844352-21844374 CCTCAGAGCGGCGGCGGCGGGGG - Intergenic
1145694519 17:26775727-26775749 CCTCAGTGCCGCGGCGGCGGGGG - Intergenic
1145925653 17:28644948-28644970 GCCGGCGGCGGCGGCGGCGGCGG - Intronic
1146142389 17:30379181-30379203 GCTGAGGGAGGCGGCGGCCGCGG + Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1146356937 17:32142488-32142510 GCGGGCTGTGGCGGCGGCGGCGG - Exonic
1147200645 17:38799425-38799447 GCCCGGGGCGGCGGCGGCGGCGG + Exonic
1147308506 17:39579775-39579797 GCTGCATGCGGCGGGGGAGGAGG - Intergenic
1147400415 17:40177551-40177573 GCTCTGCGCTGCGGCGGCAGAGG - Intronic
1147406977 17:40219366-40219388 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1147591849 17:41688981-41689003 GCGGAAGGCGGCGGCGGCGGTGG - Exonic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1148060098 17:44830238-44830260 GCGGGAGGCGGCGGCGGCGGCGG - Intronic
1148268240 17:46243606-46243628 TCTGCGGGCGGCGGCGGCGCGGG + Intergenic
1148550026 17:48544649-48544671 GCGGGGAGTGGCGGCGGCGGTGG + Exonic
1148551921 17:48555672-48555694 GCTTTGCGGGGCGGGGGCGGGGG - Intronic
1148556183 17:48580163-48580185 GAGTTGCGCGGCGGCGGCGGAGG - Intronic
1148615785 17:48998498-48998520 GCGGGGTGGCGCGGCGGCGGCGG + Intronic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1148786839 17:50149735-50149757 GCGGGCGGCGGCGGCGGCGGGGG + Exonic
1148786922 17:50150092-50150114 GGCGGGTGCGGCGGCGGCGCAGG + Exonic
1148836565 17:50468836-50468858 GCTGGGGGCAGCAGCGGCGGCGG + Exonic
1149678448 17:58487546-58487568 GCTGAGAACGGCGGCGGTGGCGG + Intronic
1149994578 17:61399987-61400009 TCTGTGCGCGGGGGCGGCGGGGG - Exonic
1150060591 17:62065383-62065405 GCTCGCGGCGGCGGCGGCGGCGG - Intergenic
1150060592 17:62065386-62065408 GCTGCTCGCGGCGGCGGCGGCGG - Intergenic
1150108660 17:62479262-62479284 GCGTGGAGCGGCGGCGGCGGCGG + Exonic
1150317149 17:64178547-64178569 CCTGTGTGTGGCGGTGGGGGTGG + Intronic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150643453 17:66964576-66964598 CCGGAGCGCGGCGGCGGCGGGGG + Intergenic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791895 17:68205762-68205784 GACTTGGGCGGCGGCGGCGGCGG - Intergenic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151370871 17:73645325-73645347 GCCGGGAGGGGCGGCGGCGGCGG + Intergenic
1151565085 17:74893283-74893305 GCGGGGTGCGGCGGAGGTGGCGG - Intronic
1151674121 17:75589190-75589212 GCTGGCTGCGGCGGCGGCTGCGG + Intergenic
1151763964 17:76122580-76122602 GCTGAGTGTGGCGGGAGCGGAGG + Intergenic
1151768987 17:76147398-76147420 GCTGGTGGTGGCGGCGGCGGTGG - Intronic
1151784832 17:76270409-76270431 GCTGTGGGCGGTGGAGGTGGTGG - Exonic
1151828691 17:76537565-76537587 GCTTTGCTCGGCGGCGGCGGTGG + Exonic
1152075518 17:78157317-78157339 CCTGTGTTCAGCAGCGGCGGCGG + Intronic
1152321410 17:79610439-79610461 GGTGGCTGTGGCGGCGGCGGCGG - Intergenic
1152362540 17:79839349-79839371 GGGGCGAGCGGCGGCGGCGGCGG - Exonic
1152363681 17:79843652-79843674 TGTGAGCGCGGCGGCGGCGGCGG - Intergenic
1152721899 17:81927506-81927528 GGTGAGTGCGGCTGCGGCGGCGG - Exonic
1153514389 18:5891017-5891039 GCTGCTAGCGGCTGCGGCGGCGG + Exonic
1153767400 18:8387475-8387497 GCAGTGGGCGGCGGAGGCAGGGG - Intronic
1153848278 18:9069358-9069380 GCTTTGTGAGGCCGAGGCGGAGG + Intergenic
1154173775 18:12068433-12068455 GGTGTGGGCCCCGGCGGCGGCGG - Intergenic
1154174490 18:12076548-12076570 GGAGGCTGCGGCGGCGGCGGCGG - Intergenic
1155392264 18:25350114-25350136 GCTGGCTGCGGCGGGGGCGGGGG - Intronic
1155392492 18:25351142-25351164 GCTCTGCACGACGGCGGCGGCGG + Intronic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1155954213 18:31943294-31943316 GCGGTGGGCGGGGGCGGGGGCGG + Intronic
1156099671 18:33578480-33578502 GGTGGCGGCGGCGGCGGCGGCGG - Intergenic
1156446938 18:37243904-37243926 GATGACGGCGGCGGCGGCGGCGG + Exonic
1157354070 18:46917368-46917390 AGTGGGTGCGGCGGCAGCGGCGG - Intronic
1157354083 18:46917419-46917441 GCTGGAGGCGGCGGCGGCCGTGG - Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1157384299 18:47248309-47248331 GGTGGCGGCGGCGGCGGCGGGGG + Intronic
1157706800 18:49813963-49813985 GCGGGGCGCGGCGGCGGCGGCGG + Intronic
1157867203 18:51197235-51197257 GGTGGCGGCGGCGGCGGCGGGGG + Exonic
1157867234 18:51197332-51197354 GCTGTCAATGGCGGCGGCGGCGG + Intronic
1158436048 18:57435986-57436008 GCTGGGCACGGCGGCAGCGGCGG + Exonic
1158602135 18:58864146-58864168 GCTGTCTGGGGAGGGGGCGGGGG - Intronic
1158954141 18:62523554-62523576 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1158954698 18:62526614-62526636 CGGGTGCGCGGCGGCGGCGGCGG - Intronic
1159603018 18:70446479-70446501 GGTGTGTGTGGCGGAGGGGGTGG + Intergenic
1159731804 18:72035932-72035954 GCTGTTGGGGGCGGGGGCGGTGG + Intergenic
1159937510 18:74380959-74380981 GCTGTGTCTGGCAGTGGCGGTGG + Intergenic
1160075158 18:75667571-75667593 GCTGTGGGAGGTGGCGGGGGTGG - Intergenic
1160080759 18:75725219-75725241 GCCCTGTGGGGCGGGGGCGGGGG - Intergenic
1160204508 18:76822305-76822327 GGTGGGGGCGGGGGCGGCGGCGG - Intergenic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719128 19:589888-589910 GCTCCGGCCGGCGGCGGCGGCGG + Exonic
1160719166 19:590009-590031 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719180 19:590048-590070 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160738809 19:676604-676626 GGGGGGCGCGGCGGCGGCGGCGG + Intronic
1160786887 19:904310-904332 GCTGTGAGTGCCGGCGGTGGGGG - Intronic
1160829259 19:1095324-1095346 GGTGCGAGCGGCGGCGGCGGCGG - Exonic
1160887055 19:1354978-1355000 GCGGGGAGCGGCGGCGGCGGCGG + Intronic
1160913147 19:1483941-1483963 GCTGCGGGGGGCGGGGGCGGGGG + Exonic
1160923889 19:1533823-1533845 GCTGCCTGCGGCGGCGGCTGCGG + Intronic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1161050979 19:2164024-2164046 CCGGAGCGCGGCGGCGGCGGCGG + Intronic
1161215743 19:3094406-3094428 GGTGGCTGCGGCGGCGGCGCGGG + Exonic
1161779184 19:6279834-6279856 GCGTTGAGCGGCGGCGGCGGCGG - Exonic
1161779200 19:6279896-6279918 GCCGGGATCGGCGGCGGCGGCGG - Exonic
1161849131 19:6729960-6729982 GCTGTGTGTGGCGGGGGCGCGGG - Exonic
1161851408 19:6739732-6739754 GGTGGCTGCGGCGGCGGCGGCGG + Exonic
1161852230 19:6743598-6743620 GGTGTGTGTGGCGGGGGCGGGGG + Exonic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162022569 19:7874388-7874410 GCTGCGGGCTGCGGCGCCGGGGG + Exonic
1162027706 19:7903914-7903936 GCGGTGCGCGGCGGCGGTGGCGG + Exonic
1162030914 19:7916916-7916938 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1162100493 19:8335740-8335762 GCTGCGTGCGCCCCCGGCGGCGG + Exonic
1162111918 19:8404032-8404054 GCTGTGTGCGGAGGAGCGGGTGG - Exonic
1162312433 19:9914851-9914873 GCTGAGGGCGACGGCGGCGGCGG - Intronic
1162421537 19:10568599-10568621 GCTGAGTGGGGCGGCGGCCCGGG - Exonic
1162470937 19:10871702-10871724 GATGGCAGCGGCGGCGGCGGCGG + Exonic
1162560981 19:11418246-11418268 AGTGTGTGGGGCGGGGGCGGGGG - Intronic
1162778626 19:12995500-12995522 GGCGGCTGCGGCGGCGGCGGCGG + Intergenic
1162778651 19:12995607-12995629 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1162934162 19:13972879-13972901 GGTGGTGGCGGCGGCGGCGGGGG - Exonic
1162954503 19:14090784-14090806 CGCGCGTGCGGCGGCGGCGGCGG - Intronic
1162959494 19:14117623-14117645 GCGCTGGGCGGCGGCGGCGGCGG + Exonic
1163085944 19:14979783-14979805 GCTGGGCGCGGGGGAGGCGGAGG - Intronic
1163138814 19:15332512-15332534 GCTGGCGGCGGCGGCGGCGGCGG - Intronic
1163146154 19:15380237-15380259 TCTGGGGGCGGCGGCGGTGGCGG + Exonic
1163154485 19:15432517-15432539 GGTGGTGGCGGCGGCGGCGGGGG + Intronic
1163282409 19:16325639-16325661 GGTGTGTCGGGCGGCGGCGGGGG - Exonic
1163508024 19:17719690-17719712 GCGGGGTGGGGCGGCGGCGGCGG + Intronic
1163615212 19:18323054-18323076 AGCGTGTGCAGCGGCGGCGGCGG - Exonic
1163631396 19:18419615-18419637 GGTGTGGGCCCCGGCGGCGGCGG + Exonic
1163715218 19:18869247-18869269 GCGTTTCGCGGCGGCGGCGGCGG - Exonic
1163715219 19:18869250-18869272 GCTGCGTTTCGCGGCGGCGGCGG - Exonic
1163715320 19:18869575-18869597 GCGGGGTGCGGCGGGGGGGGTGG + Intronic
1163743892 19:19033489-19033511 GCCTCGCGCGGCGGCGGCGGCGG - Intronic
1164639257 19:29812348-29812370 GGTGAGGGCGGCGGGGGCGGCGG + Intronic
1164669395 19:30064095-30064117 GCTGTGTGCTGCAGAGGAGGGGG + Intergenic
1164995850 19:32720144-32720166 GCTGTGCGCGGCTGGGGTGGGGG - Intronic
1165114574 19:33521472-33521494 ACCGTGTGCGGCTGCGGTGGGGG - Intronic
1165243051 19:34482254-34482276 GCGGGGTCCGACGGCGGCGGCGG + Exonic
1165349623 19:35268882-35268904 GGCGGCTGCGGCGGCGGCGGCGG + Intergenic
1165453900 19:35900079-35900101 GCTGAGTGCGGGGGGGGGGGGGG - Intronic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165520293 19:36309439-36309461 GGAGGTTGCGGCGGCGGCGGCGG - Intergenic
1165624320 19:37271683-37271705 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165625404 19:37276748-37276770 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165625937 19:37279273-37279295 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165626481 19:37281800-37281822 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165627020 19:37284325-37284347 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165627563 19:37286849-37286871 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165628640 19:37291899-37291921 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165629723 19:37296950-37296972 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165630265 19:37299477-37299499 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165630804 19:37302015-37302037 GGAGGTTGCGGCGGCGGCGGTGG + Intergenic
1165696917 19:37907466-37907488 GCCGTGGGGGGCGGCGGCGCCGG + Intronic
1165772102 19:38385928-38385950 GGTGTGGGCGGTGGCAGCGGTGG + Exonic
1165803159 19:38565278-38565300 GGCGCGTGCGGCGGCTGCGGCGG + Exonic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1165850898 19:38849836-38849858 GCGGCGGGCGGCGGAGGCGGCGG - Exonic
1165995480 19:39840634-39840656 GGTGGAGGCGGCGGCGGCGGTGG - Exonic
1166106930 19:40602174-40602196 TGTGTGTGTGGCGGCGGGGGTGG + Intronic
1166310562 19:41960003-41960025 GGTGTGTGTGGCGGGGTCGGAGG - Intergenic
1166375158 19:42323856-42323878 GCTGGGGGCGGCGGCGGGGCCGG - Intronic
1166546997 19:43639801-43639823 GGAGCGAGCGGCGGCGGCGGCGG - Exonic
1166869526 19:45863114-45863136 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1166876646 19:45901868-45901890 TCTGGGAGAGGCGGCGGCGGGGG - Intronic
1166888037 19:45973386-45973408 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
1166975113 19:46601293-46601315 GCGGGAGGCGGCGGCGGCGGCGG + Exonic
1167076179 19:47250911-47250933 GCTCTGTGGGGAGGCGGGGGAGG - Intergenic
1167134431 19:47608673-47608695 GCTGGGGGCGGGGGCGGCGCCGG + Intronic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456978 19:49601565-49601587 GCTGGCTGTGGCGGCGGAGGGGG - Exonic
1167463827 19:49639977-49639999 GTCGTGGGCGGCGGCGGCGTGGG - Exonic
1167488286 19:49776194-49776216 GATGCGGGCGGCGGCGGGGGCGG - Intronic
1167557472 19:50205305-50205327 CAGGTGGGCGGCGGCGGCGGCGG - Intronic
1167649081 19:50719734-50719756 GGAGCGGGCGGCGGCGGCGGCGG - Intergenic
1168076323 19:53982538-53982560 GCGGGGGCCGGCGGCGGCGGCGG + Exonic
1168076347 19:53982598-53982620 GCCGGGGGCGGCGGCGGAGGCGG + Exonic
1168286925 19:55339909-55339931 GGTGTTGGCGGCGGCGGCGCGGG + Exonic
1168340825 19:55622158-55622180 GGTGATGGCGGCGGCGGCGGCGG - Exonic
1202710973 1_KI270714v1_random:19204-19226 GCCGTGGGCGGCGGCGGCGCTGG + Intergenic
925191980 2:1892366-1892388 GCTGTGTGTGGCTGAGGCCGGGG - Intronic
925818358 2:7775381-7775403 GCTGTGTGTGGCGGGGTGGGGGG + Intergenic
925927802 2:8682534-8682556 GGAGTGTGCGGCGGCGGGGCGGG - Intronic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
926216950 2:10911788-10911810 GCGGTGCGCGGTGGTGGCGGCGG + Intergenic
927168647 2:20350512-20350534 GCTTTGTGCGGCGGCCTCGGCGG - Intronic
927215829 2:20667357-20667379 CCAGGGGGCGGCGGCGGCGGCGG + Exonic
927606501 2:24491236-24491258 GCGGGGGGCGGTGGCGGCGGCGG + Intergenic
928303689 2:30147850-30147872 GCAGAGCGCGGCGGCGGCGGTGG - Intronic
928606360 2:32947628-32947650 GCAGGCTCCGGCGGCGGCGGCGG - Exonic
928964884 2:36966543-36966565 GGTGTGGGCGGGAGCGGCGGAGG - Intergenic
928983219 2:37156919-37156941 GCCGGCGGCGGCGGCGGCGGCGG - Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929218118 2:39437125-39437147 GAGGGGAGCGGCGGCGGCGGCGG - Exonic
929778357 2:44942288-44942310 GCAGGCGGCGGCGGCGGCGGCGG + Exonic
929936501 2:46297720-46297742 GCTAGGTGCGGGGGCGGGGGTGG - Exonic
930011252 2:46940378-46940400 TCTGTGAGCTGCGGCGGCAGCGG + Intronic
930091500 2:47534519-47534541 TCTGTGTGTGGGGGCGGGGGGGG - Intronic
930136229 2:47906060-47906082 GCGAAGCGCGGCGGCGGCGGCGG + Intergenic
930358224 2:50346885-50346907 CCCGGGGGCGGCGGCGGCGGCGG - Intronic
931252921 2:60549905-60549927 GGTGTGCGCGGCGGCGGCTGCGG + Intronic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
931253670 2:60553284-60553306 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
933666713 2:84970829-84970851 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
933772671 2:85754131-85754153 GCTGAGCGCGGCGGCGGCCCGGG + Exonic
933772775 2:85754559-85754581 GCAGGAGGCGGCGGCGGCGGCGG - Exonic
933908136 2:86914492-86914514 CCGGGCTGCGGCGGCGGCGGCGG + Intronic
934011478 2:87824873-87824895 TTAATGTGCGGCGGCGGCGGCGG - Intronic
934079054 2:88452279-88452301 CCGGGGGGCGGCGGCGGCGGCGG + Exonic
934079065 2:88452320-88452342 GGCGGCTGCGGCGGCGGCGGAGG + Exonic
934296791 2:91748932-91748954 GCTGGAGGCGGCGGCGGCGGCGG - Intergenic
935354698 2:102187587-102187609 GGAGTAGGCGGCGGCGGCGGTGG - Intronic
935592437 2:104855284-104855306 GCCGGGGGCCGCGGCGGCGGCGG + Intergenic
935592499 2:104855414-104855436 GGGGGGCGCGGCGGCGGCGGCGG + Intergenic
935592556 2:104855610-104855632 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
935592699 2:104856106-104856128 GAGGTGCGCGGCGGCGGCGGCGG - Exonic
935746564 2:106194295-106194317 ACAATGCGCGGCGGCGGCGGCGG + Exonic
936122654 2:109760338-109760360 CCTAAGAGCGGCGGCGGCGGCGG + Intergenic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126698 2:109794579-109794601 CCGGGGGGCGGCGGCGGCGGCGG + Intronic
936221995 2:110611037-110611059 GCCGGGGGCGGTGGCGGCGGCGG - Intergenic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
936222039 2:110611135-110611157 CCTAGGAGCGGCGGCGGCGGCGG - Intergenic
936412772 2:112275429-112275451 TCTCTGTGCAGCGGCGGAGGCGG - Intergenic
936954976 2:118014114-118014136 GCAGGCGGCGGCGGCGGCGGCGG - Exonic
937044991 2:118846555-118846577 CCCGGCTGCGGCGGCGGCGGCGG - Exonic
937221911 2:120346712-120346734 GCGGGCTGCGGTGGCGGCGGTGG - Intronic
938397905 2:130964159-130964181 GTGGTGTGTGGCGGCCGCGGAGG + Intronic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
938440853 2:131331150-131331172 GCAGCTGGCGGCGGCGGCGGCGG + Intronic
938451543 2:131425329-131425351 GCAGGCGGCGGCGGCGGCGGCGG - Intergenic
939153802 2:138501750-138501772 CGTGCGCGCGGCGGCGGCGGCGG - Intergenic
939900503 2:147844598-147844620 GCGGCGGGCGGCAGCGGCGGCGG - Exonic
940344945 2:152619538-152619560 GGAGGGGGCGGCGGCGGCGGTGG - Exonic
940775083 2:157876297-157876319 GGAGGCTGCGGCGGCGGCGGCGG + Intergenic
941666380 2:168247357-168247379 GGTGACAGCGGCGGCGGCGGCGG - Exonic
941951503 2:171160856-171160878 GCTGTGGGTGGCGGCTGAGGCGG + Intronic
942045162 2:172095657-172095679 GGTGTGTGTGGGGGCGGGGGTGG + Intergenic
942046514 2:172102297-172102319 GCGGGCGGCGGCGGCGGCGGGGG - Exonic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942241241 2:173965102-173965124 GCTGTGGTCGGCGGCAGCGGCGG + Intronic
942446146 2:176080255-176080277 GGTGGTGGCGGCGGCGGCGGGGG - Exonic
942448399 2:176093076-176093098 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
942454824 2:176130411-176130433 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
942565918 2:177264657-177264679 TCTGGTGGCGGCGGCGGCGGCGG + Exonic
942565919 2:177264660-177264682 GGTGGCGGCGGCGGCGGCGGTGG + Exonic
943060631 2:183038409-183038431 ACTAGGTGTGGCGGCGGCGGCGG + Exonic
943725323 2:191246084-191246106 GCGGTGTGCCCCGGCGGCGGCGG + Intronic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
944675849 2:202033876-202033898 GCGGGCGGCGGCGGCGGCGGCGG + Intergenic
944743686 2:202635416-202635438 GCAGGCGGCGGCGGCGGCGGTGG + Exonic
944811248 2:203328893-203328915 GCGGAGTGCGGGGGCGGCCGAGG - Intronic
944933632 2:204545556-204545578 GGAGTGGGCGGCGGCGGCGGCGG - Intergenic
945102502 2:206274946-206274968 GGTGAGTGCCGCGGCGGGGGCGG + Exonic
945699413 2:213151713-213151735 GCTGGCGGCGGCTGCGGCGGCGG + Intronic
945699415 2:213151719-213151741 GGCGGCTGCGGCGGCGGCGGCGG + Intronic
946322126 2:218960283-218960305 GCTGGGGGAGGCGGCGGCGGAGG - Exonic
946865658 2:224039289-224039311 GCTGGCTGCCGCGGCGGCGGGGG + Intronic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947044875 2:225970459-225970481 GGTGTGTGCGGCGGGGGTGGGGG + Intergenic
947353643 2:229271346-229271368 GGTCCGGGCGGCGGCGGCGGGGG - Intergenic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947593079 2:231395969-231395991 GGCGGGCGCGGCGGCGGCGGCGG + Intronic
948116037 2:235494634-235494656 GCGCGGGGCGGCGGCGGCGGGGG + Exonic
948207007 2:236167781-236167803 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
948801648 2:240435948-240435970 GCTATGTGCGGCCGCAGCGCTGG + Exonic
948824683 2:240568506-240568528 GCGCCGGGCGGCGGCGGCGGCGG - Intronic
948945835 2:241218348-241218370 GTTGTGCGCGGCGGCGAAGGAGG - Exonic
1168883255 20:1225644-1225666 ACTGGGCGCGGCGGCGGCGGCGG - Intergenic
1169065563 20:2692798-2692820 CCCGGGAGCGGCGGCGGCGGCGG + Intergenic
1169065592 20:2692865-2692887 GCGGCGGGCGGCGGCGGCCGCGG + Exonic
1169673753 20:8132308-8132330 GCGCTTTGAGGCGGCGGCGGCGG + Intronic
1170150448 20:13221546-13221568 CCGTGGTGCGGCGGCGGCGGCGG + Intergenic
1170150505 20:13221723-13221745 GCGGCGGCCGGCGGCGGCGGCGG - Intergenic
1170454061 20:16516274-16516296 GCTGTGTGGGGCTGGGGTGGGGG + Intronic
1170612137 20:17923371-17923393 GCAGTGGGGGGCGGGGGCGGGGG - Intergenic
1171977593 20:31605413-31605435 GCTGGGGCCCGCGGCGGCGGTGG - Exonic
1172010933 20:31845194-31845216 GCCGGGTGAAGCGGCGGCGGCGG + Exonic
1172015531 20:31870547-31870569 GGAGCCTGCGGCGGCGGCGGTGG - Exonic
1172073665 20:32277725-32277747 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1172143956 20:32743420-32743442 GCTGAGCAGGGCGGCGGCGGCGG - Exonic
1172474530 20:35226888-35226910 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1172587287 20:36093512-36093534 GCGGTGGGTGGCGGCGGCGGGGG + Intronic
1172951200 20:38724433-38724455 GCGGAGGGCGGCGGCGGCGGCGG - Intergenic
1172951201 20:38724436-38724458 GCTGCGGAGGGCGGCGGCGGCGG - Intergenic
1172978934 20:38926673-38926695 GGAGGGCGCGGCGGCGGCGGCGG + Exonic
1173221798 20:41137610-41137632 GCTGGGGGCGGCGGCGGCACAGG - Exonic
1173454156 20:43189987-43190009 GCGGGCGGCGGCGGCGGCGGCGG - Intergenic
1173548167 20:43914869-43914891 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1173672933 20:44810487-44810509 GCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1173672934 20:44810490-44810512 GCTGGCGGCGGCGGCGGCGGCGG + Intergenic
1174307900 20:49627533-49627555 GCTGTGTGGGGCGGGCGTGGTGG + Intergenic
1174357821 20:50010099-50010121 GCCGGCAGCGGCGGCGGCGGCGG + Intergenic
1174380712 20:50153735-50153757 GCCGGGCGCGGCGGCGGCGCGGG + Intergenic
1174386663 20:50191523-50191545 GCGGGCGGCGGCGGCGGCGGGGG - Exonic
1174386666 20:50191526-50191548 TCGGCGGGCGGCGGCGGCGGCGG - Exonic
1174565755 20:51463361-51463383 GCTGTGGGCCTCGGTGGCGGGGG + Intronic
1175278167 20:57786020-57786042 TGTGTGTGGGGCGGCGGTGGTGG + Intergenic
1175340937 20:58228605-58228627 GCGGCGGGCGGCGGCGGGGGCGG - Exonic
1175715512 20:61252438-61252460 GGTCTCGGCGGCGGCGGCGGCGG + Exonic
1175847530 20:62066301-62066323 GCCGTGCGCGGTGGCAGCGGCGG + Intergenic
1175863309 20:62161580-62161602 GGTGAGTGCGGCGGGGGAGGAGG + Exonic
1175975507 20:62708645-62708667 GCAGTGGGGGGTGGCGGCGGAGG - Intergenic
1176379658 21:6105727-6105749 GCTCCGTGCGGCGGCATCGGGGG - Intergenic
1176549393 21:8214729-8214751 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176549399 21:8214747-8214769 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1176549732 21:8216028-8216050 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176550164 21:8217357-8217379 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176557286 21:8258952-8258974 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176557294 21:8258976-8258998 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1176557623 21:8260257-8260279 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176568321 21:8397763-8397785 GGTCGGGGCGGCGGCGGCGGTGG + Intergenic
1176568327 21:8397781-8397803 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1176568657 21:8399062-8399084 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176569092 21:8400392-8400414 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176576228 21:8441987-8442009 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1176576236 21:8442011-8442033 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1176576568 21:8443291-8443313 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1176577006 21:8444627-8444649 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1176861732 21:14014792-14014814 ACTGTGGGCAGCGGGGGCGGGGG - Intergenic
1176952587 21:15064684-15064706 GCCGTTTCCGGCGGCGCCGGCGG + Intronic
1177014995 21:15775750-15775772 GCAGAGTGCAGCGGGGGCGGGGG - Intronic
1177543145 21:22521194-22521216 GTTGTGTGCGGGGGTGGGGGCGG + Intergenic
1177686532 21:24444171-24444193 GGTGTGTGTGGCGGGGGAGGAGG + Intergenic
1178280142 21:31274964-31274986 GCTGGGTGTGGTGGGGGCGGGGG + Intronic
1178961914 21:37073294-37073316 GGTGGCGGCGGCGGCGGCGGCGG + Intronic
1178992580 21:37367536-37367558 GCTGGCTGCGGAGGCCGCGGCGG + Intronic
1179502559 21:41819461-41819483 GGTGGGTGTGGCGGGGGCGGGGG - Intronic
1179561593 21:42219238-42219260 CCCGGGGGCGGCGGCGGCGGCGG - Exonic
1179674890 21:42974689-42974711 GGCGAGAGCGGCGGCGGCGGCGG - Intronic
1179743816 21:43432510-43432532 GCTCCGTGCGGCGGCATCGGGGG + Intergenic
1180042859 21:45288712-45288734 GCTGCGGGGAGCGGCGGCGGCGG - Intergenic
1180095923 21:45555295-45555317 GCAGGGGGCGGCGGGGGCGGCGG + Intergenic
1180096020 21:45555528-45555550 GCAGGGGGCGGCGGCGGGGGCGG + Intergenic
1180899615 22:19360909-19360931 GCTGTGTGTGGAGGTGGAGGTGG + Intronic
1180949413 22:19714464-19714486 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1180960691 22:19761057-19761079 TAGGCGTGCGGCGGCGGCGGCGG - Exonic
1180961936 22:19766182-19766204 TCTGCGGGCGGCGGCGGCGGCGG - Intronic
1181299198 22:21867457-21867479 GCTCAGCGCGGCGGAGGCGGCGG - Exonic
1181387630 22:22557626-22557648 GCTGCGTGGGGCGGGGGGGGCGG + Intronic
1181574792 22:23786998-23787020 GTCGTCTGCGGCGGCGGCGGCGG + Exonic
1181793073 22:25282863-25282885 GCTGGCGGCGGCGGCGGCGGTGG + Intergenic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1181966006 22:26657275-26657297 CCTTTGTGCGGCGGGGGCTGCGG + Intergenic
1182137460 22:27919237-27919259 GCTGTGAGAGGCGGTAGCGGCGG - Exonic
1182355361 22:29720300-29720322 GCGGAGGGCGGCGGCGGCAGCGG - Exonic
1182374725 22:29838211-29838233 GTGGTCGGCGGCGGCGGCGGCGG - Exonic
1182374727 22:29838214-29838236 ACCGTGGTCGGCGGCGGCGGCGG - Exonic
1183427204 22:37746304-37746326 GCCGAGAGGGGCGGCGGCGGCGG + Intronic
1183444476 22:37844084-37844106 GCGCTGGGCGGCGGCGGCGCGGG - Exonic
1183524934 22:38317293-38317315 GCGGAGCGCGGCGGCGGCGGCGG - Exonic
1184101559 22:42343912-42343934 GCCGTGCGCGCCGGCGGGGGAGG + Intergenic
1184153011 22:42649345-42649367 GGTCTCGGCGGCGGCGGCGGCGG - Intronic
1184184636 22:42856797-42856819 GCTCTGAGCGGAGGCGGGGGCGG - Intronic
1184236737 22:43187101-43187123 ACGGCGGGCGGCGGCGGCGGTGG - Exonic
1184386124 22:44175658-44175680 GCTGTGTGCCGCTGAGGCGTTGG + Intronic
1184412235 22:44331891-44331913 CATGAGCGCGGCGGCGGCGGCGG - Intergenic
1184412250 22:44331946-44331968 GAAGTGGGCAGCGGCGGCGGCGG - Intergenic
1184465785 22:44668479-44668501 GCTGTGGGCGGCGCCCGCCGGGG - Intergenic
1184465895 22:44668764-44668786 GCTCTGCGCGGTGGCAGCGGCGG + Intronic
1184620329 22:45671911-45671933 GCGGGCTGCAGCGGCGGCGGCGG + Exonic
1184698027 22:46150552-46150574 GCAGCGGGCGGCGGGGGCGGAGG + Intronic
1185037934 22:48489463-48489485 CCCGGGCGCGGCGGCGGCGGCGG + Exonic
1185255058 22:49827371-49827393 GCCATGTTTGGCGGCGGCGGCGG - Intronic
1185272765 22:49936342-49936364 GGGGTGTGCGGCGGCGGCGGTGG - Intergenic
1185335790 22:50270372-50270394 GCGGAGGGCGGCGGAGGCGGCGG + Exonic
1185408682 22:50671878-50671900 GCTGTTTGCCGGGGTGGCGGTGG + Intergenic
1203254278 22_KI270733v1_random:131045-131067 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203254286 22_KI270733v1_random:131069-131091 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1203254618 22_KI270733v1_random:132349-132371 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203255057 22_KI270733v1_random:133689-133711 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203262334 22_KI270733v1_random:176124-176146 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203262342 22_KI270733v1_random:176148-176170 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1203262674 22_KI270733v1_random:177428-177450 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203263113 22_KI270733v1_random:178768-178790 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
949709945 3:6861460-6861482 CCTGTGCGCGCTGGCGGCGGCGG + Exonic
950215284 3:11154479-11154501 GCTGGGTGTCGCGGGGGCGGCGG - Intronic
950316308 3:12004651-12004673 CCGGGGGGCGGCGGCGGCGGCGG - Exonic
950829413 3:15859593-15859615 CCTCTCGGCGGCGGCGGCGGCGG - Exonic
951080468 3:18445299-18445321 GCGGTGCGCAGCAGCGGCGGCGG - Intronic
951208323 3:19947265-19947287 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
951217620 3:20040179-20040201 GGCGTGTGCTGTGGCGGCGGCGG + Exonic
951485285 3:23203232-23203254 GCCGGGGGCGGCGGCAGCGGCGG + Intronic
951640366 3:24829325-24829347 GCTCTCAGCGGCGGCGGCAGGGG + Intergenic
952744449 3:36764220-36764242 GCCGGGGGCGGCGGCGGCTGCGG + Intergenic
952889264 3:38029859-38029881 CCCGTGGGTGGCGGCGGCGGAGG - Intergenic
952890833 3:38039408-38039430 GCTGCGTGAGGCGGCGGGGCCGG - Exonic
953464355 3:43105909-43105931 GCTGGGGGCGGCGGCGGGGTGGG - Exonic
953627240 3:44581027-44581049 GGTCGGCGCGGCGGCGGCGGCGG + Intronic
953773478 3:45796532-45796554 GCTAGCTGCGTCGGCGGCGGAGG - Exonic
954004205 3:47578822-47578844 GCGGCGGACGGCGGCGGCGGCGG - Exonic
954004225 3:47578883-47578905 GCTGAGCGCAGCGGCGGCAGCGG - Exonic
954249692 3:49358242-49358264 GCTAGCGGCGGCGGCGGCGGCGG - Exonic
955769234 3:62372519-62372541 GGTGGCGGCGGCGGCGGCGGGGG - Exonic
955911537 3:63863791-63863813 GGCGTGCGCGGCGGCGGCGGCGG + Exonic
955916482 3:63912637-63912659 GCGCCGCGCGGCGGCGGCGGCGG + Exonic
956122371 3:65979091-65979113 GCTGTGGGGGGTGGCGGGGGGGG - Intronic
956144905 3:66182705-66182727 GCAGTGGGCGGCGGGGGGGGGGG + Intronic
956659487 3:71583802-71583824 GCCGGTGGCGGCGGCGGCGGCGG + Intronic
956678184 3:71754286-71754308 GCGGCGTGCGGCGGCCGCGGCGG + Exonic
956978923 3:74614445-74614467 GGTGGCGGCGGCGGCGGCGGCGG - Intergenic
956978929 3:74614463-74614485 ACTAACTGCGGCGGCGGCGGTGG - Intergenic
956978970 3:74614599-74614621 GCGCTTGGCGGCGGCGGCGGTGG - Intergenic
961495568 3:127288534-127288556 GGTGTGTGAGGTGGGGGCGGGGG + Intergenic
961612733 3:128153484-128153506 GGTGTCCGAGGCGGCGGCGGCGG + Exonic
961698824 3:128726142-128726164 GCTCGGGGCGGCGGCGGTGGCGG + Exonic
961827173 3:129605294-129605316 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
961858266 3:129893734-129893756 GTTGTGGGCGGTGGCGGCTGTGG - Intergenic
962277961 3:134030051-134030073 CCTGTCTGAGGGGGCGGCGGCGG - Exonic
962793993 3:138835010-138835032 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
963038377 3:141051391-141051413 GGAGCGGGCGGCGGCGGCGGAGG + Exonic
963236738 3:142963696-142963718 TCCGGGGGCGGCGGCGGCGGAGG - Intergenic
963827286 3:149970200-149970222 GCTGTGGGAGGCGGCGGCCCCGG - Intronic
963835156 3:150050725-150050747 GATGGCGGCGGCGGCGGCGGGGG + Intronic
963870223 3:150408469-150408491 GCTGTGTGAGGTAGCGGTGGTGG - Exonic
964252723 3:154737744-154737766 GGGGTGGGGGGCGGCGGCGGGGG + Intergenic
964482783 3:157159580-157159602 GCTGTTCGCAGCGGCGGCGGCGG - Intronic
965166225 3:165196488-165196510 GCTCGCGGCGGCGGCGGCGGCGG + Intronic
965757213 3:172039618-172039640 TATTTGAGCGGCGGCGGCGGCGG + Intronic
966866516 3:184261468-184261490 GCAGGCGGCGGCGGCGGCGGTGG + Intronic
967316241 3:188154195-188154217 GGTGGCGGCGGCGGCGGCGGCGG - Intronic
967316242 3:188154198-188154220 GGTGGTGGCGGCGGCGGCGGCGG - Intronic
967859680 3:194141536-194141558 GGAGCGGGCGGCGGCGGCGGCGG + Intergenic
967859681 3:194141539-194141561 GCGGGCGGCGGCGGCGGCGGCGG + Intergenic
968659639 4:1793709-1793731 GCCCTGGGCGGCGGCGGCGGCGG + Intronic
968674715 4:1871347-1871369 CCCGGCTGCGGCGGCGGCGGCGG + Intergenic
968674736 4:1871432-1871454 GGAGGGGGCGGCGGCGGCGGCGG - Intronic
968775105 4:2535916-2535938 CCTGGGTGCGGAGGCAGCGGCGG - Intronic
968965149 4:3765926-3765948 GCGCAGGGCGGCGGCGGCGGCGG + Intergenic
969413354 4:7043477-7043499 CTCGTGCGCGGCGGCGGCGGCGG + Exonic
970456222 4:16226555-16226577 GATGGCGGCGGCGGCGGCGGCGG - Intronic
970456223 4:16226558-16226580 GCGGATGGCGGCGGCGGCGGCGG - Intronic
970637110 4:18021680-18021702 GCACTGAGCGGCGGCGGCGGCGG + Exonic
971405933 4:26320878-26320900 GCTCTTCGCGGCGGCGGCGAGGG + Intronic
972321555 4:37977365-37977387 GCTCTCCCCGGCGGCGGCGGCGG - Intronic
972533049 4:39977563-39977585 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
973110313 4:46390089-46390111 GCGGTGCGCGCCGGCGGTGGCGG + Intronic
973759061 4:54100567-54100589 TCTGTGGGCGCCGGCAGCGGGGG + Exonic
975778961 4:77819608-77819630 GGTCCGGGCGGCGGCGGCGGCGG + Intronic
975965191 4:79964770-79964792 TCTGTTTGCAGCGGCGGCAGCGG - Intronic
976246471 4:83010798-83010820 GGTGGTGGCGGCGGCGGCGGCGG - Exonic
977176843 4:93829017-93829039 GGTGGCTGCGGCGGCGGCGGCGG - Exonic
977257548 4:94757916-94757938 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
977574070 4:98658689-98658711 GCTGCGGGCGGCGCGGGCGGAGG - Intergenic
977810069 4:101347535-101347557 GTTGGCGGCGGCGGCGGCGGCGG - Intronic
977810070 4:101347538-101347560 GGTGTTGGCGGCGGCGGCGGCGG - Intronic
978072532 4:104491312-104491334 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
978072577 4:104491432-104491454 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
978072623 4:104491551-104491573 GATGCGCGCGGCGGCCGCGGCGG + Exonic
978282344 4:107034205-107034227 GCTGTGGACAGGGGCGGCGGAGG + Intronic
979785575 4:124712431-124712453 CCGGGGGGCGGCGGCGGCGGTGG - Intronic
979785645 4:124712701-124712723 CCTGACGGCGGCGGCGGCGGCGG - Exonic
980405031 4:132344804-132344826 GCTGTGCGGGGCTGCGGCTGGGG + Intergenic
980405056 4:132344883-132344905 GCTGTGCGGGGCTGCGGCTGGGG + Intergenic
981093427 4:140756155-140756177 GCTAGGTGCGGCGGCGGCGGCGG + Intergenic
981270746 4:142845727-142845749 GCCGGCGGCGGCGGCGGCGGCGG + Intronic
981615440 4:146639297-146639319 GCTGGTGGTGGCGGCGGCGGCGG + Exonic
981615441 4:146639300-146639322 GGTGGTGGCGGCGGCGGCGGCGG + Exonic
981615442 4:146639303-146639325 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
982712253 4:158769133-158769155 GCCGGGGGCGGCGGCCGCGGTGG - Exonic
983416093 4:167456787-167456809 GGTGGTGGCGGCGGCGGCGGCGG + Intergenic
983416094 4:167456790-167456812 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
984206501 4:176792877-176792899 GGGCTGAGCGGCGGCGGCGGCGG + Intergenic
984526222 4:180861834-180861856 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
984668064 4:182449085-182449107 TGGGTGAGCGGCGGCGGCGGCGG + Intronic
984668102 4:182449204-182449226 GGTGGTGGCGGCGGCGGCGGCGG + Intronic
984668103 4:182449207-182449229 GGTGGCGGCGGCGGCGGCGGCGG + Intronic
984804604 4:183739727-183739749 ACTGTGTGAGGTGGCGGGGGCGG - Intergenic
984888761 4:184473564-184473586 CTTCTGAGCGGCGGCGGCGGCGG + Intronic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
985580568 5:693485-693507 GCCGGGTGGGGCGGCGGGGGCGG - Intergenic
985782465 5:1878380-1878402 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
985894270 5:2739627-2739649 GCGGGGTCCGGCGGCGACGGCGG - Intergenic
986297083 5:6448725-6448747 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
986330558 5:6713773-6713795 CCGGCGTGGGGCGGCGGCGGCGG - Intergenic
986330584 5:6713849-6713871 GGTGGCGGCGGCGGCGGCGGCGG - Intergenic
986330586 5:6713852-6713874 GCCGGTGGCGGCGGCGGCGGCGG - Intergenic
986338866 5:6773855-6773877 GGTGTGTGGGGGAGCGGCGGGGG - Intergenic
986338975 5:6774142-6774164 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986338983 5:6774164-6774186 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986338991 5:6774186-6774208 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986338999 5:6774208-6774230 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986339007 5:6774230-6774252 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986339015 5:6774252-6774274 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986339023 5:6774274-6774296 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986339046 5:6774335-6774357 GGTGTGTGGGGGAGCGGCGGGGG - Intergenic
986339056 5:6774357-6774379 GGTGTGTGGGGGAGCGGCGGGGG - Intergenic
986339072 5:6774399-6774421 GGTGTGTGTGGGAGCGGCGGGGG - Intergenic
986339080 5:6774421-6774443 GGTGTGTGGGGGAGCGGCGGGGG - Intergenic
986676160 5:10187720-10187742 GCTGGCTGGGGCGGGGGCGGGGG - Intergenic
986748090 5:10761378-10761400 GCTGTGGCCGGGGGCGGGGGCGG + Intergenic
986813638 5:11385083-11385105 GTAGAGCGCGGCGGCGGCGGCGG + Exonic
987035126 5:14011719-14011741 GCAGGGCGCGGCGGCTGCGGCGG - Intergenic
987050403 5:14143567-14143589 GCGGCGGGGGGCGGCGGCGGCGG - Intergenic
987087992 5:14487541-14487563 GGTGGGGGCAGCGGCGGCGGCGG + Exonic
987132393 5:14871817-14871839 CCTCCGGGCGGCGGCGGCGGCGG - Intergenic
987258269 5:16179475-16179497 GGCGTCGGCGGCGGCGGCGGGGG + Exonic
987319184 5:16751756-16751778 GCTGGGAGCGGTGGGGGCGGTGG - Intronic
988609539 5:32711858-32711880 GGCGTTGGCGGCGGCGGCGGTGG + Exonic
989103326 5:37839693-37839715 CCTGTTGGCGGCGGCGGCGGCGG - Intergenic
989812571 5:45695873-45695895 GGTGGCGGCGGCGGCGGCGGCGG - Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
990955123 5:61332711-61332733 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
990955318 5:61333337-61333359 GCTGTGCGGGGCGGGGGAGGGGG + Intronic
991590319 5:68244525-68244547 GCTCTCTGAAGCGGCGGCGGGGG - Intronic
992105724 5:73448040-73448062 GGTGGGGGCGGCGGCGGCGGCGG - Exonic
992837492 5:80654944-80654966 ACTATGTGCGGCGGCAGCTGGGG - Exonic
993901217 5:93585108-93585130 GCGGCCCGCGGCGGCGGCGGCGG + Exonic
994043625 5:95284671-95284693 GCTGGCGGTGGCGGCGGCGGCGG + Intergenic
994043627 5:95284677-95284699 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
994072826 5:95620849-95620871 GACGTTGGCGGCGGCGGCGGCGG - Exonic
994353847 5:98773903-98773925 GCTGCTTGCTGCGGCGGTGGTGG + Intronic
995106239 5:108381018-108381040 GGGGGCTGCGGCGGCGGCGGCGG - Exonic
995224954 5:109690754-109690776 GCGGCGTGCGGCGGCGGCGGCGG + Intronic
995567757 5:113449504-113449526 GCTGTGTGCTGCCTCAGCGGAGG + Intronic
995650364 5:114362185-114362207 GAGGAGCGCGGCGGCGGCGGCGG - Exonic
997319144 5:132963523-132963545 GCTGACTGAGGCGGCGGGGGCGG + Exonic
997426816 5:133808863-133808885 TTTGTGTGCGGGGGCGGTGGGGG - Intergenic
997560968 5:134846015-134846037 ACCGTGCGCGGCGGCCGCGGCGG + Exonic
997899619 5:137753384-137753406 GGTGGTTACGGCGGCGGCGGAGG - Exonic
997975461 5:138439240-138439262 TGTGAGTGCGGCGGCGGCGGGGG + Exonic
997980929 5:138466988-138467010 GCTCTGGGAGGCGGAGGCGGAGG - Exonic
998143229 5:139711331-139711353 GCGCTCGGCGGCGGCGGCGGCGG - Intergenic
998199414 5:140107825-140107847 GCCGTCTGCGGCGGCGGCGGCGG + Intronic
998406719 5:141878404-141878426 AGTGTGTGAGGCGGCGGCGGCGG + Exonic
1000045424 5:157518297-157518319 GCTGTGTGTGGAGGTGGGGGAGG + Intronic
1000279897 5:159773401-159773423 GACGTCTGCGGCGGCGGCGGCGG + Intergenic
1000326363 5:160175585-160175607 GGTGTGGGCGGCGGAGGTGGGGG - Intergenic
1001070314 5:168579585-168579607 TCTCAGTGCGGCGGCGGCGGCGG - Exonic
1001563325 5:172684099-172684121 GCCGTGCGCGGCGGCGTCGCGGG + Exonic
1001638805 5:173231219-173231241 GGTGGTGGCGGCGGCGGCGGTGG - Intergenic
1001639135 5:173232900-173232922 GCAGGCGGCGGCGGCGGCGGGGG + Exonic
1001688742 5:173616411-173616433 GCGGACGGCGGCGGCGGCGGGGG - Exonic
1001688800 5:173616585-173616607 GGTGGGGGCGGCGGCGGCGAAGG + Exonic
1002180059 5:177426688-177426710 GCTGGCTGCGGCGGCCGGGGAGG + Intronic
1002186011 5:177455166-177455188 GCCGTTTGAGGCGGCGGCGCAGG - Exonic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002897860 6:1389751-1389773 TCTGGCGGCGGCGGCGGCGGCGG - Intergenic
1002897861 6:1389754-1389776 GCTTCTGGCGGCGGCGGCGGCGG - Intergenic
1002927344 6:1611900-1611922 GGCGAGCGCGGCGGCGGCGGCGG + Exonic
1003049236 6:2765362-2765384 GCCGTTTGCCCCGGCGGCGGAGG - Intergenic
1003175860 6:3751869-3751891 GGTCTCTGCGGAGGCGGCGGGGG - Exonic
1004043936 6:12009118-12009140 GGTGGCGGCGGCGGCGGCGGCGG + Intronic
1004193971 6:13487708-13487730 GCTGGCGGCGGCGGGGGCGGGGG - Intergenic
1004199613 6:13535658-13535680 GGTGTGTGCAGGGGCGGCGGGGG - Intergenic
1004216789 6:13711267-13711289 GCGGTGGCCGGGGGCGGCGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1004504731 6:16238659-16238681 CCTGGCTGCGGCGGCGGCGACGG - Exonic
1004690340 6:17987677-17987699 GCGGGGCGCGGCGGCGGCGGCGG + Intergenic
1005040307 6:21595030-21595052 CATGGGGGCGGCGGCGGCGGCGG + Exonic
1005135981 6:22570112-22570134 GGAGAGGGCGGCGGCGGCGGCGG + Exonic
1006089679 6:31620922-31620944 GGTGGCGGCGGCGGCGGCGGTGG + Intronic
1006558561 6:34889496-34889518 TTTGGGGGCGGCGGCGGCGGTGG + Exonic
1007656745 6:43455332-43455354 GCTGGGTTCGGCGGCGGCGCGGG + Intronic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1007784202 6:44270779-44270801 GCCGGCGGCGGCGGCGGCGGTGG + Exonic
1007902222 6:45422759-45422781 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
1008369183 6:50714132-50714154 CGTGTGTGTGGCGGCGGCGGCGG + Intronic
1008673317 6:53794984-53795006 GCTCCGCGCGGCGGCGGGGGCGG + Exonic
1009418639 6:63441823-63441845 GCTTTGTGCAGCGGGGGCGCTGG + Intergenic
1009437567 6:63635835-63635857 TCGGCGTGCGGCGGCGGCGCGGG - Exonic
1009808828 6:68635558-68635580 GAAGTGACCGGCGGCGGCGGCGG - Exonic
1010198461 6:73263031-73263053 CCTGAGTAGGGCGGCGGCGGCGG + Exonic
1010386332 6:75284729-75284751 GGTGGCTGCGGCGGCGGCGGCGG - Exonic
1010386333 6:75284732-75284754 GCTGGTGGCTGCGGCGGCGGCGG - Exonic
1011075144 6:83430918-83430940 GATGGGTGTGGCGGCGACGGGGG + Exonic
1011128764 6:84033788-84033810 GCGGTGGGAGGCGGCGGCGGCGG + Exonic
1013155820 6:107490322-107490344 GTTGGCTGCGGCGGCGGCGGCGG + Exonic
1013155867 6:107490537-107490559 GGTGGCGGCGGCGGCGGCGGTGG - Exonic
1013155868 6:107490540-107490562 GGTGGTGGCGGCGGCGGCGGCGG - Exonic
1013170829 6:107635077-107635099 GCGGGCGGCGGCGGCGGCGGCGG - Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1013836602 6:114342418-114342440 GCAGGCGGCGGCGGCGGCGGCGG + Exonic
1014137541 6:117907191-117907213 GCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1014137710 6:117907817-117907839 GCCGAGGGCAGCGGCGGCGGCGG + Exonic
1015965587 6:138693074-138693096 GCTCTGGGCGGCGGCGGCCGCGG + Intergenic
1016431114 6:143987315-143987337 GCTGTGTTCGGAGGCTGAGGTGG - Intronic
1016714142 6:147204240-147204262 GCGGAGCGAGGCGGCGGCGGCGG + Intergenic
1016923327 6:149317419-149317441 GCAGGCGGCGGCGGCGGCGGCGG - Intronic
1016923328 6:149317422-149317444 GCAGCAGGCGGCGGCGGCGGCGG - Intronic
1017103094 6:150865728-150865750 GCAGGCGGCGGCGGCGGCGGCGG - Exonic
1017103152 6:150865913-150865935 GCTAGCAGCGGCGGCGGCGGAGG + Exonic
1017164213 6:151391765-151391787 GCTGCAGGCGGCGGCGGCGGCGG - Intergenic
1017672009 6:156777812-156777834 GCGCGGCGCGGCGGCGGCGGCGG + Intergenic
1017672202 6:156778575-156778597 GCCGTGCCCGGGGGCGGCGGCGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672283 6:156778845-156778867 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1017672319 6:156778977-156778999 GCAGGAGGCGGCGGCGGCGGCGG + Exonic
1017793624 6:157823033-157823055 CCCGGGGGCGGCGGCGGCGGCGG + Intronic
1017842351 6:158232212-158232234 GCGGGGGGAGGCGGCGGCGGCGG + Intergenic
1018156730 6:160992010-160992032 GGTGGTGGCGGCGGCGGCGGTGG - Exonic
1018613156 6:165662537-165662559 TCTGCGCGCGGCGGCGGCTGCGG - Intronic
1018613396 6:165663267-165663289 GCGGAAGGCGGCGGCGGCGGCGG - Intronic
1018935928 6:168274076-168274098 GCTGGGTGCGGGGGGGGGGGGGG + Intergenic
1019343561 7:519438-519460 GATCGGTGTGGCGGCGGCGGCGG - Intronic
1019344713 7:523565-523587 GCTGTGTGCAGTGACGGCTGTGG - Intergenic
1019399387 7:843383-843405 GTTGTGCGCGGTGGCGGCGGCGG - Exonic
1019440226 7:1042222-1042244 GCTGTGTGCCGTGGCTGCTGAGG - Intronic
1019562632 7:1666079-1666101 CCCGAGCGCGGCGGCGGCGGCGG - Intergenic
1019655637 7:2193394-2193416 GCTGGGTGCGGAGGCGGGGAAGG - Intronic
1019731509 7:2631931-2631953 GGAGGGGGCGGCGGCGGCGGCGG + Exonic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1020034902 7:4958951-4958973 GAGGTGAGCGGCGGCCGCGGAGG - Exonic
1020204567 7:6104972-6104994 GCTGTGTGCGGCGGCGGCGGCGG + Exonic
1021313151 7:19117065-19117087 GCGGGCTGTGGCGGCGGCGGCGG - Exonic
1021451278 7:20785409-20785431 GCTGGAGGCGGCGGCTGCGGCGG + Exonic
1021451281 7:20785418-20785440 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
1022090046 7:27102135-27102157 GGTGGCTGCGGCGGTGGCGGCGG + Exonic
1022101883 7:27173864-27173886 GGTGGTTGCGGCGGGGGCGGCGG + Exonic
1022101954 7:27174140-27174162 GCGGGGGGCGGCGGCGGTGGCGG - Exonic
1022960184 7:35418905-35418927 GGTGGTGGCGGCGGCGGCGGTGG + Intergenic
1023417892 7:39949852-39949874 TCTGCTGGCGGCGGCGGCGGCGG + Intergenic
1023872322 7:44269678-44269700 GCACTGGGCGGGGGCGGCGGAGG + Intronic
1023881935 7:44325662-44325684 GGCGGGCGCGGCGGCGGCGGCGG - Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069787 7:55887860-55887882 GCGGGCGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025187751 7:56874306-56874328 ACTGTGTCCGGTGGCGGCCGAGG - Intergenic
1025739046 7:64182022-64182044 GGCGGCTGCGGCGGCGGCGGCGG - Intronic
1025916894 7:65873255-65873277 GGTGGTGGCGGCGGCGGCGGAGG + Intronic
1025916924 7:65873339-65873361 GCGGAGGGAGGCGGCGGCGGCGG + Intronic
1026100982 7:67384322-67384344 GCTGGCTGGGGCGGGGGCGGGGG + Intergenic
1026360533 7:69598377-69598399 GCTGAGGCGGGCGGCGGCGGCGG + Intergenic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1026360535 7:69598383-69598405 GCGGGCGGCGGCGGCGGCGGCGG + Intergenic
1026732645 7:72925121-72925143 GATGTCTCCGGCGGCTGCGGCGG + Intronic
1027111419 7:75442698-75442720 GATGTCTCCGGCGGCTGCGGCGG - Intronic
1027138198 7:75639196-75639218 GCAGGCGGCGGCGGCGGCGGCGG + Intronic
1027283648 7:76627231-76627253 GATGTCTCCGGCGGCTGCGGCGG - Exonic
1027507457 7:79035197-79035219 TGTGTGTGTGGTGGCGGCGGGGG + Intronic
1027539888 7:79453606-79453628 GGCGTCGGCGGCGGCGGCGGCGG + Intergenic
1028585566 7:92447883-92447905 ACTGGGGGCAGCGGCGGCGGCGG + Exonic
1029168932 7:98617438-98617460 GCTGAGCGCGGCAGCGGCGGCGG + Exonic
1029276556 7:99408558-99408580 GGCGGCTGCGGCGGCGGCGGCGG + Exonic
1029281571 7:99438993-99439015 AGTGTGTGCGGCGGGGCCGGCGG + Intronic
1029459515 7:100686973-100686995 GCTGAGGGCGGCGGCCGGGGCGG - Intronic
1029461137 7:100694370-100694392 GCGGAGGGAGGCGGCGGCGGCGG - Intergenic
1029607229 7:101606343-101606365 GCTGTGGGAGCCGGCGGCGCCGG + Intergenic
1029640404 7:101816402-101816424 GCTGGCGGCGGCGGCGGCGCGGG - Intronic
1030055843 7:105583163-105583185 GCTGAGGGCGGGGGCGGCGGGGG + Intronic
1031406252 7:121390842-121390864 GCTGTGTGGGGCGGGGGGGGGGG + Intronic
1031886587 7:127251665-127251687 GCCAGGTGCGGCGGGGGCGGAGG - Intronic
1031910657 7:127513504-127513526 GCAGTGTGCGGCGGCGGCGGCGG - Intergenic
1032011795 7:128351981-128352003 GCTGGGGCGGGCGGCGGCGGCGG - Exonic
1032015852 7:128380122-128380144 GCTGGGTGCAGCGGAGGGGGTGG + Intergenic
1032020753 7:128406091-128406113 CCTTTGTGCGGCGCGGGCGGAGG - Intronic
1032174795 7:129613788-129613810 GCTGGGAGGGGCGGGGGCGGGGG + Intronic
1032306225 7:130734169-130734191 GGCGGCTGCGGCGGCGGCGGCGG - Intergenic
1032470581 7:132175580-132175602 GCTGTGTGTGGCGGCAGCTCAGG + Intronic
1033033217 7:137846767-137846789 GCTGGCGGCGGCGGCGGCGGCGG + Exonic
1033390699 7:140924769-140924791 GCTGGGGGAGGCGGAGGCGGAGG + Intergenic
1033899302 7:146116212-146116234 GCTGGCGGCGGCGGCGGCGGCGG + Intergenic
1034206618 7:149321673-149321695 GCTGTTGGCGGCGGCGGCTGCGG + Intergenic
1034522626 7:151632323-151632345 GCCACCTGCGGCGGCGGCGGCGG - Intronic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1035273996 7:157736545-157736567 GCTGTGGGGGGCGGCGGGGGTGG - Intronic
1037529216 8:19757321-19757343 GCGGGGAGCAGCGGCGGCGGCGG + Intronic
1037535230 8:19817441-19817463 GGTGGCGGCGGCGGCGGCGGTGG + Exonic
1038575642 8:28701615-28701637 GCAGGCGGCGGCGGCGGCGGCGG + Exonic
1038828532 8:31033119-31033141 GCTGGCGGTGGCGGCGGCGGTGG - Exonic
1038828543 8:31033162-31033184 GCGGGGGGCGGCGGCTGCGGCGG - Exonic
1038828554 8:31033190-31033212 AGTGCGAGCGGCGGCGGCGGGGG - Exonic
1039024810 8:33246277-33246299 GCTGTGTGCAGCTGAGGCTGTGG - Intergenic
1039454399 8:37697670-37697692 GCCGTGAGCCGCGGCGGCGGTGG + Exonic
1039454607 8:37698427-37698449 GCAGGAGGCGGCGGCGGCGGCGG - Exonic
1039467849 8:37796890-37796912 GCACGGAGCGGCGGCGGCGGCGG + Intronic
1039476504 8:37841773-37841795 GGTGTGCGAGGCGGGGGCGGCGG + Exonic
1039864723 8:41490733-41490755 GCTGTTTTCGGCGGCGGGTGGGG + Exonic
1040055854 8:43056410-43056432 GGTGGGTGCGGCTGGGGCGGGGG - Exonic
1041280997 8:56211311-56211333 GACGTCGGCGGCGGCGGCGGCGG - Intronic
1041355302 8:56993640-56993662 GGCGGCTGCGGCGGCGGCGGCGG - Exonic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1042039970 8:64580471-64580493 GCTCAGAGCGGCGGCGGCGGCGG + Exonic
1042040218 8:64581385-64581407 GGCCTGGGCGGCGGCGGCGGCGG + Exonic
1042722904 8:71843925-71843947 GCTGGGGGCGGCGGCGCAGGTGG - Exonic
1043463921 8:80486780-80486802 GCACCGGGCGGCGGCGGCGGCGG + Exonic
1043568276 8:81571477-81571499 GGTGTGGGCGGCGGCAGCAGAGG - Intergenic
1044115251 8:88327519-88327541 GCTGGAGGCGGCGGCGGCGGCGG - Intronic
1044115268 8:88327583-88327605 GCTGGGGGCGGCGGCGGCGGCGG - Intronic
1044335971 8:90985227-90985249 GCTGACCGCGGTGGCGGCGGCGG + Exonic
1045222575 8:100213256-100213278 GGCCTCTGCGGCGGCGGCGGCGG + Exonic
1045516387 8:102863962-102863984 GCTGTGTGCAGCAGTGGCGGCGG + Exonic
1045547420 8:103141007-103141029 GCTGTCCGGGGCGGCGGCGCTGG - Exonic
1045564363 8:103298792-103298814 GCTCGCGGCGGCGGCGGCGGCGG - Intronic
1045582968 8:103499916-103499938 GCACTGAGCGGCGGCGGCGCAGG + Intergenic
1046547420 8:115669079-115669101 GCCGGGCGGGGCGGCGGCGGCGG - Intronic
1046659966 8:116938480-116938502 GCAGGAGGCGGCGGCGGCGGCGG + Exonic
1046770368 8:118111692-118111714 GCTGGAGGCGGCGGCGGCGGCGG + Exonic
1046871296 8:119208379-119208401 GAGCTGAGCGGCGGCGGCGGCGG + Exonic
1048214131 8:132480477-132480499 GCTGGCGGCGGCGGCGACGGGGG - Exonic
1048981173 8:139703923-139703945 GGCGGGCGCGGCGGCGGCGGCGG + Intergenic
1048997640 8:139804284-139804306 GTTGTGTGTGGTGGCGGTGGTGG - Intronic
1048997697 8:139804512-139804534 GTTGTGTGTGGTGGCGGTGGTGG - Intronic
1049109799 8:140635654-140635676 GCGGCGGGCGGAGGCGGCGGCGG + Intergenic
1049109850 8:140635783-140635805 GGGGTCCGCGGCGGCGGCGGCGG + Intergenic
1049206885 8:141367659-141367681 GCTGTGTGCGGGGCAGGAGGGGG + Intergenic
1049419486 8:142510588-142510610 GCTGGGGGCGGCGGGGGCGCGGG + Intronic
1049419530 8:142510708-142510730 GCTCTCGGCGGCGGCGGCGGCGG + Intronic
1049658077 8:143807662-143807684 GCTGGGTGAGGCGGTGGTGGTGG - Intronic
1049659998 8:143815611-143815633 GCGGGGAGCGGCGGCGGCGGCGG + Intergenic
1049668805 8:143860552-143860574 GCGGCGGGCGGCGGCGGTGGCGG + Exonic
1049669220 8:143862154-143862176 GCGGCGGGCGGCGGCGGTGGCGG + Exonic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049670046 8:143865352-143865374 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1049778959 8:144418775-144418797 GCTGTGGGAGGCCGGGGCGGGGG + Intergenic
1051038289 9:12775857-12775879 GGTGGTGGCGGCGGCGGCGGCGG + Exonic
1053010309 9:34629064-34629086 GCTGCTTGCGGCGGCCGCGGGGG + Intergenic
1053114609 9:35490119-35490141 GCCGGCGGCGGCGGCGGCGGCGG - Intronic
1053181253 9:35972255-35972277 GCTGAGGGCGGGGGCGGCGTGGG + Intergenic
1054407656 9:64774849-64774871 GGCGGCTGCGGCGGCGGCGGGGG + Intergenic
1054738478 9:68780234-68780256 GGTGGCAGCGGCGGCGGCGGGGG + Exonic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055514166 9:77020162-77020184 ACCATGTGCGGCGGCGGCGGGGG - Exonic
1055611780 9:78031590-78031612 GCAGGCGGCGGCGGCGGCGGCGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056038527 9:82635569-82635591 TGTGTGTGTGGCGGCGGGGGGGG + Intergenic
1056799530 9:89681465-89681487 GCGGCGGGGGGCGGCGGCGGTGG - Intergenic
1057259762 9:93576982-93577004 CCGGAATGCGGCGGCGGCGGCGG - Intronic
1057547260 9:96027609-96027631 GCGCTGGGCGGCGGCGGCGCCGG - Intergenic
1057758424 9:97854432-97854454 GATGGCGGCGGCGGCGGCGGCGG - Exonic
1057922019 9:99105253-99105275 GCTGGCGGCGGCGGCGGCGGCGG + Exonic
1057995730 9:99820546-99820568 TGTGTGTGTGGCGGGGGCGGGGG - Intergenic
1057996127 9:99822741-99822763 GCTCTCGGCGGCGGCGGCGGCGG + Intronic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1059061319 9:111037975-111037997 GCTGTGGGCCGCGGCGCGGGTGG - Exonic
1059375281 9:113876270-113876292 GGAGGGAGCGGCGGCGGCGGCGG + Exonic
1059483714 9:114611531-114611553 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060209084 9:121699431-121699453 ATTGTCCGCGGCGGCGGCGGCGG - Exonic
1060280804 9:122214248-122214270 GCAGTGGGCGGCGGGGGCGGGGG - Intronic
1060480440 9:124013991-124014013 GCGCTGTGCGCCGGCTGCGGGGG + Exonic
1060481374 9:124018433-124018455 GCAGGGGGCGGCGGCGGGGGAGG - Intronic
1060599588 9:124869150-124869172 GCTGCGCGCGGAGGCGGTGGAGG + Exonic
1060700601 9:125746938-125746960 GCGGCGGGCGGCGGCGGAGGAGG - Intergenic
1060770182 9:126326830-126326852 ACCGAGAGCGGCGGCGGCGGCGG - Exonic
1060814069 9:126625702-126625724 GGTGGCGGCGGCGGCGGCGGAGG - Intronic
1061208509 9:129177626-129177648 GGGCTGCGCGGCGGCGGCGGCGG - Exonic
1061453502 9:130681626-130681648 GTGGTGCGCGGCGGCGGCGGCGG - Exonic
1061541081 9:131278040-131278062 GCAGGCGGCGGCGGCGGCGGCGG + Intergenic
1061648866 9:132029863-132029885 GGTGTGTGTGGGGGCGGGGGAGG + Intronic
1061666182 9:132162060-132162082 TCTGACGGCGGCGGCGGCGGCGG + Exonic
1061840545 9:133356441-133356463 GCCGGGTGCGATGGCGGCGGTGG - Exonic
1062162469 9:135087829-135087851 GCGCGGGGCGGCGGCGGCGGCGG + Exonic
1062285093 9:135769363-135769385 GCTGTGTGGGGCAGCGGGAGGGG + Intronic
1062305765 9:135906707-135906729 CCCGTTGGCGGCGGCGGCGGCGG - Intronic
1062372179 9:136245668-136245690 GCTGCTAGCGGCGGCGGCGGTGG - Exonic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1062574563 9:137200218-137200240 GCGGGCGGCGGCGGCGGCGGCGG + Exonic
1062587392 9:137255437-137255459 GGTGTCTGCGGCGGCGCCGGGGG + Exonic
1203470679 Un_GL000220v1:114189-114211 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203470687 Un_GL000220v1:114213-114235 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1203471019 Un_GL000220v1:115493-115515 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203471457 Un_GL000220v1:116829-116851 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1203478500 Un_GL000220v1:158161-158183 GGTCGGGGCGGCGGCGGCGGCGG + Intergenic
1203478508 Un_GL000220v1:158185-158207 GGTGGCGGCGGCGGCGGCGGCGG + Intergenic
1203478840 Un_GL000220v1:159465-159487 TCGGAGGGCGGCGGCGGCGGCGG + Intergenic
1203479278 Un_GL000220v1:160801-160823 TCGGCGCGCGGCGGCGGCGGCGG + Intergenic
1186426070 X:9465133-9465155 GGCGGGCGCGGCGGCGGCGGCGG - Exonic
1186496374 X:10015308-10015330 GCCGGCAGCGGCGGCGGCGGCGG + Intergenic
1187181403 X:16946748-16946770 GGTGGTGGCGGCGGCGGCGGCGG + Exonic
1187181404 X:16946751-16946773 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1187363693 X:18649978-18650000 CCTGAGCGGGGCGGCGGCGGCGG - Intronic
1187518155 X:19990953-19990975 GCCGGCGGCGGCGGCGGCGGCGG - Intergenic
1187826190 X:23334804-23334826 GGTTCGGGCGGCGGCGGCGGCGG - Exonic
1188005518 X:25013597-25013619 GCGGTTGGCGGTGGCGGCGGAGG + Exonic
1188005541 X:25013682-25013704 TCAGGGTGCGGCAGCGGCGGCGG - Exonic
1188542644 X:31266920-31266942 GCTGTGAGCTTGGGCGGCGGCGG - Intronic
1188650599 X:32627152-32627174 GCTGTGTCCTGGGGCGGGGGGGG - Intronic
1189324666 X:40105335-40105357 CGTGACTGCGGCGGCGGCGGCGG - Intronic
1189821481 X:44873371-44873393 GGTGAAGGCGGCGGCGGCGGCGG - Intronic
1189961275 X:46327077-46327099 TGTGTGTGTGGCGGCGGGGGCGG + Intergenic
1190279206 X:48918483-48918505 GGTGCGTGTGGCGGGGGCGGGGG - Intronic
1190285293 X:48957446-48957468 GGTGTGGGCGTGGGCGGCGGCGG - Exonic
1190474404 X:50813134-50813156 CCTGGCGGCGGCGGCGGCGGCGG + Intronic
1190713059 X:53083055-53083077 GCAGGAGGCGGCGGCGGCGGCGG + Exonic
1191055072 X:56232702-56232724 GGGGTGTGCGGCGGCAACGGCGG + Intronic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1192034363 X:67546509-67546531 GGTGGTGGCGGCGGCGGCGGCGG + Exonic
1192034364 X:67546512-67546534 GGTGGCGGCGGCGGCGGCGGCGG + Exonic
1192924996 X:75747070-75747092 GGTGGCGGCGGCGGCGGCGGCGG - Intergenic
1193654993 X:84187997-84188019 GCTGGGGGTCGCGGCGGCGGCGG - Intergenic
1195235274 X:102890584-102890606 GCTGTGTGCAGAGGTGGGGGTGG + Intergenic
1195716745 X:107825921-107825943 GCTGGGAGTGGCGGGGGCGGCGG + Exonic
1195803256 X:108735666-108735688 GCTGGCGGCGGCAGCGGCGGCGG - Exonic
1196421685 X:115528721-115528743 GCTGTGTGCAGGGGTGGGGGCGG + Intergenic
1197710861 X:129666168-129666190 GCTGGGTGGGGGGGCGGGGGAGG + Intergenic
1197776330 X:130120882-130120904 GCGGAACGCGGCGGCGGCGGCGG + Intergenic
1197991467 X:132322730-132322752 GCAGTGGGCGGGGGCGGGGGTGG - Intergenic
1198158507 X:133985349-133985371 GTGGCGTCCGGCGGCGGCGGCGG + Exonic
1198276371 X:135098594-135098616 TCTGTCTGCGGCGGCGGCGGCGG - Intergenic
1198310137 X:135422149-135422171 TCTGTCTGCAGCGGCGGCTGCGG + Intergenic
1198388141 X:136147718-136147740 GCCCCGAGCGGCGGCGGCGGCGG - Intronic
1198424067 X:136497338-136497360 CCGGTCGGCGGCGGCGGCGGTGG + Exonic
1198775870 X:140178538-140178560 GCGGGGTGGGGGGGCGGCGGCGG - Intergenic
1199612733 X:149631765-149631787 TCTCCGGGCGGCGGCGGCGGCGG - Exonic
1199699511 X:150365112-150365134 GTTGGCGGCGGCGGCGGCGGGGG - Intronic
1199699514 X:150365115-150365137 ATTGTTGGCGGCGGCGGCGGCGG - Intronic
1199736865 X:150693539-150693561 GCCGGCGGCGGCGGCGGCGGCGG + Exonic
1199745372 X:150769044-150769066 GCTGGTTCGGGCGGCGGCGGCGG + Exonic
1199772772 X:150984524-150984546 GCCGGGGGCGGCGGCGGTGGCGG - Intronic
1200000277 X:153056562-153056584 GCTATGCGCGGCGGCGGCGGCGG - Intronic
1200003195 X:153072530-153072552 GCTGCGCGCCGCTGCGGCGGCGG - Exonic
1200004528 X:153077479-153077501 GCTGCGCGCCGCTGCGGCGGCGG + Intergenic
1200100667 X:153688048-153688070 GGTGGTGGCGGCGGCGGCGGTGG - Intronic
1200155579 X:153972933-153972955 CCCGGGCGCGGCGGCGGCGGCGG + Intronic
1200173765 X:154097636-154097658 GCTCGGCGCGGCGGCGGCGGCGG + Exonic
1200227808 X:154428782-154428804 GTCGTTGGCGGCGGCGGCGGCGG + Exonic
1200227809 X:154428785-154428807 GTTGGCGGCGGCGGCGGCGGCGG + Exonic
1200233652 X:154458283-154458305 TGTGTGGGCGGCGGCGGCGGCGG + Exonic