ID: 1020204570

View in Genome Browser
Species Human (GRCh38)
Location 7:6104982-6105004
Sequence GCGGCGGCGGCGGCGGCCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2879
Summary {0: 1, 1: 29, 2: 411, 3: 653, 4: 1785}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020204559_1020204570 4 Left 1020204559 7:6104955-6104977 CCCCGCCGGGCGGCTGGGCTGTG 0: 1
1: 1
2: 0
3: 21
4: 231
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204551_1020204570 28 Left 1020204551 7:6104931-6104953 CCCGGATGGAGGCACGTCATTGT 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204558_1020204570 5 Left 1020204558 7:6104954-6104976 CCCCCGCCGGGCGGCTGGGCTGT 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204552_1020204570 27 Left 1020204552 7:6104932-6104954 CCGGATGGAGGCACGTCATTGTC 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204562_1020204570 -1 Left 1020204562 7:6104960-6104982 CCGGGCGGCTGGGCTGTGTGCGG 0: 1
1: 0
2: 2
3: 20
4: 247
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204560_1020204570 3 Left 1020204560 7:6104956-6104978 CCCGCCGGGCGGCTGGGCTGTGT 0: 1
1: 0
2: 3
3: 9
4: 178
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785
1020204561_1020204570 2 Left 1020204561 7:6104957-6104979 CCGCCGGGCGGCTGGGCTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 215
Right 1020204570 7:6104982-6105004 GCGGCGGCGGCGGCGGCCGAGGG 0: 1
1: 29
2: 411
3: 653
4: 1785

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020204570 Original CRISPR GCGGCGGCGGCGGCGGCCGA GGG Exonic
Too many off-targets to display for this crispr