ID: 1020205201

View in Genome Browser
Species Human (GRCh38)
Location 7:6109163-6109185
Sequence GTGAACTGGCTGGAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020205195_1020205201 13 Left 1020205195 7:6109127-6109149 CCAGAGAAAGTAAAGTCTAAACT 0: 1
1: 0
2: 3
3: 34
4: 274
Right 1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG No data
1020205194_1020205201 14 Left 1020205194 7:6109126-6109148 CCCAGAGAAAGTAAAGTCTAAAC 0: 1
1: 2
2: 3
3: 32
4: 272
Right 1020205201 7:6109163-6109185 GTGAACTGGCTGGAGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020205201 Original CRISPR GTGAACTGGCTGGAGGTGGA AGG Intronic
No off target data available for this crispr