ID: 1020209821

View in Genome Browser
Species Human (GRCh38)
Location 7:6150281-6150303
Sequence GGCAAACGGTCTTCCTGGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020209815_1020209821 4 Left 1020209815 7:6150254-6150276 CCTGCACTCAGAAAATCCCTTTG 0: 1
1: 0
2: 0
3: 21
4: 205
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1020209813_1020209821 9 Left 1020209813 7:6150249-6150271 CCTGCCCTGCACTCAGAAAATCC 0: 1
1: 0
2: 1
3: 24
4: 245
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1020209810_1020209821 26 Left 1020209810 7:6150232-6150254 CCAGCTGCCAAGGCCAGCCTGCC 0: 1
1: 0
2: 8
3: 56
4: 444
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1020209812_1020209821 13 Left 1020209812 7:6150245-6150267 CCAGCCTGCCCTGCACTCAGAAA 0: 1
1: 0
2: 1
3: 37
4: 422
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1020209811_1020209821 19 Left 1020209811 7:6150239-6150261 CCAAGGCCAGCCTGCCCTGCACT 0: 1
1: 1
2: 5
3: 51
4: 537
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83
1020209814_1020209821 5 Left 1020209814 7:6150253-6150275 CCCTGCACTCAGAAAATCCCTTT 0: 1
1: 0
2: 1
3: 17
4: 270
Right 1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020209821 Original CRISPR GGCAAACGGTCTTCCTGGAA AGG Exonic
900843357 1:5075904-5075926 GGAAAACGGTTGTCCTGGGATGG + Intergenic
900843648 1:5078548-5078570 GGAAAACGGTGGTCCTGGGATGG + Intergenic
901395019 1:8974864-8974886 GGGAAACGATCATCCTGGACAGG + Intronic
902232460 1:15036483-15036505 GGCAAACGGTTTGGCAGGAAGGG + Intronic
902569346 1:17336908-17336930 GGCAAACGCTCTCCCGCGAAGGG + Intronic
902728248 1:18351459-18351481 TGTACACGGTTTTCCTGGAAGGG + Intronic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
904212375 1:28894543-28894565 GGCAACTGGACTTCCTGGAGAGG + Intronic
906882155 1:49603344-49603366 GGAAAACAGTCTTTCTAGAAAGG + Intronic
908332295 1:63082742-63082764 GGCAAACGGTGTGCCAAGAAGGG + Intergenic
916990939 1:170244142-170244164 GACAAACAGTCTTGCTGGCAAGG - Intergenic
917187892 1:172382211-172382233 GACAGACGGTCTTTCTGGACAGG + Intronic
922585761 1:226734129-226734151 GGGAAGCGGTCCACCTGGAAGGG - Intronic
1063875898 10:10478092-10478114 GGCTAACTTTTTTCCTGGAAGGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066190704 10:33053209-33053231 GGCAACTGTTCTTCCTGGTAAGG - Intergenic
1066461255 10:35614278-35614300 GGCAAGCTGGCTTCCTGGGAAGG + Intergenic
1072236961 10:93461714-93461736 GGCAAACGGGCTTTGTGGGAAGG + Intronic
1076823213 10:132952347-132952369 GGGAAGGGGTGTTCCTGGAAAGG - Intergenic
1080734257 11:34995899-34995921 GGCAAGCGGTTTACCTAGAAAGG - Exonic
1084744864 11:71163327-71163349 GGCACAGGGTCTGCCTGTAATGG + Intronic
1095183114 12:39168773-39168795 GGCAAACAGTATTCCTTGAAAGG - Intergenic
1096706515 12:53425384-53425406 GGAAAAGGGACTTCGTGGAAAGG - Intronic
1101130241 12:101682631-101682653 GACAACCAGTCTTCCTGGAGGGG + Exonic
1102441664 12:112968258-112968280 GGAAAACACTCTTCCTAGAACGG + Intronic
1103993856 12:124816610-124816632 GGCACACGGTGTTCCAGGGATGG - Intronic
1107177495 13:37416084-37416106 AGCAAAAAGCCTTCCTGGAAAGG - Intergenic
1117612320 14:57497267-57497289 AGCATACGGTTTTCTTGGAAAGG + Intergenic
1118774065 14:68962418-68962440 GGCAAATGGTGCTCCTGGGAAGG - Intronic
1120048932 14:79842398-79842420 GGCAAGGGATGTTCCTGGAAGGG + Intronic
1121208462 14:92188555-92188577 GGCATATGCGCTTCCTGGAATGG - Intergenic
1124341782 15:28894543-28894565 GGCAAAGGGCCAGCCTGGAATGG + Intronic
1126864212 15:52920053-52920075 AGCCCAGGGTCTTCCTGGAAAGG - Intergenic
1136379945 16:29888560-29888582 GGCACCCGGCCATCCTGGAACGG - Exonic
1136396728 16:29996498-29996520 GGCCAACGGTCCTCCGTGAAGGG - Intronic
1146000570 17:29128060-29128082 GGCAAGCAGTCTTCTGGGAAGGG - Intronic
1147795972 17:43043112-43043134 GGCAAAGGGTCTTACAGGAGTGG - Intergenic
1151149791 17:72075238-72075260 GGCCAATGGTCTTCTTGGGAAGG - Intergenic
1151182844 17:72342444-72342466 GGCAAACGGTGTTTATGGCATGG - Intergenic
1152190006 17:78882674-78882696 GGCAGACGGTGATCCAGGAAGGG + Intronic
1153343072 18:3995463-3995485 GGGACAAGCTCTTCCTGGAAAGG - Intronic
1157812022 18:50704049-50704071 GTCACAAGGTCTGCCTGGAAAGG - Intronic
1159404208 18:67978041-67978063 GGGAAAAGCTCTTCCTGGAGGGG + Intergenic
926039995 2:9665358-9665380 GGCAAAATGTCTTCCAGAAAAGG + Intergenic
933312397 2:80677137-80677159 GGCAAACCGTCTTACTTGCAAGG + Intergenic
938114546 2:128594427-128594449 GACCAAAGGCCTTCCTGGAAGGG - Intergenic
945615837 2:212065209-212065231 GGCAAACTAACTTCCAGGAAGGG - Intronic
946773275 2:223111381-223111403 GGGAAACTGCCTCCCTGGAAGGG + Intronic
947704930 2:232266932-232266954 GGTAAACTGACTTCTTGGAAAGG - Intronic
948747172 2:240105453-240105475 AGCAAACTGTCTTCCAGGCACGG - Intergenic
1171164329 20:22957171-22957193 GGCAAAGGGGCAGCCTGGAAGGG - Intergenic
1179032916 21:37735863-37735885 ATCAAACGGCCTTCCTTGAAAGG + Intronic
1181725221 22:24806541-24806563 GGAAAAGAGTCTTCGTGGAAGGG + Intronic
1184594681 22:45506617-45506639 GGGAAAGGGTGTTCCTGGCAGGG + Intronic
1185078685 22:48697006-48697028 GGCAAAAGGGCTTCCTTGAAGGG + Intronic
963519686 3:146348269-146348291 GGCAAACTGTCCTCCTGGTCTGG - Intergenic
968345236 3:197998775-197998797 GGTAAAAGGACTTCCTTGAAAGG - Intronic
977080183 4:92516822-92516844 AGCAGACTGTATTCCTGGAAAGG - Intronic
981773652 4:148339173-148339195 GGCAGACGATCAGCCTGGAAGGG + Intronic
982879833 4:160699741-160699763 GGGAAACTGTCTTCCTTCAAAGG - Intergenic
986578494 5:9237219-9237241 GACACATAGTCTTCCTGGAAAGG + Intronic
990198985 5:53349834-53349856 GGCTAGCTGTCTTCCTGGAATGG - Intergenic
990548865 5:56852061-56852083 GGCAAAGGGTATTCCTGGCAGGG + Intronic
993671754 5:90769047-90769069 GTCAAATGCTCTTCCTGGCATGG - Intronic
993832703 5:92779194-92779216 AGCAAAAGGAGTTCCTGGAAAGG - Intergenic
1002026098 5:176397223-176397245 GGTACAAGGTCTTCCAGGAAGGG - Intronic
1002082200 5:176743676-176743698 GGTAAACAGGCCTCCTGGAAAGG - Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1003044262 6:2718475-2718497 GGCAAAGAGTTTTCCTTGAAAGG - Intronic
1003098997 6:3163011-3163033 GGCAAACGGTAGTTCGGGAAAGG + Intergenic
1004529701 6:16442320-16442342 GGCAACCAGTCTGGCTGGAAAGG + Intronic
1005313190 6:24579085-24579107 GGCAACCGTTCTTCCTCTAAAGG + Intronic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1022785149 7:33631227-33631249 GGCTGAGGGTCTCCCTGGAACGG - Intergenic
1023829677 7:44031504-44031526 GGACAACTGTCTGCCTGGAAGGG + Intergenic
1026689822 7:72541902-72541924 GGCAAGCGGTTTACCTAGAAAGG + Intergenic
1029739987 7:102485763-102485785 GGAAGACTGTCTGCCTGGAAGGG + Intronic
1029757984 7:102584942-102584964 GGAAGACTGTCTGCCTGGAAGGG + Intronic
1029775921 7:102684003-102684025 GGAAGACTGTCTGCCTGGAATGG + Intergenic
1044704322 8:94993960-94993982 GGGAAAAGGTCTTCTGGGAAAGG + Intronic
1045485588 8:102628463-102628485 GGCAAACGTTACTCCTGAAAAGG - Intergenic
1049005658 8:139854021-139854043 GGCAAATGGTCTCACTGAAAGGG + Intronic
1049436890 8:142590528-142590550 GCCAAACAGACATCCTGGAAGGG - Intergenic
1052089077 9:24304822-24304844 AGCAAACTGTATTCCTGGACTGG - Intergenic
1054756625 9:68965311-68965333 GGCAGAGGGTGTCCCTGGAAAGG + Intronic
1055704852 9:78986923-78986945 GGCATATTGTCCTCCTGGAAAGG + Intergenic
1060055471 9:120409260-120409282 GGCTCACGGTCTTCCTGGAGAGG + Exonic
1186890730 X:13956947-13956969 GGAAAAAGGAATTCCTGGAATGG + Intergenic
1189631082 X:42953954-42953976 AGCAAGCGGTGTTCCTGGAGAGG + Intergenic
1190752448 X:53374054-53374076 GGCAAGAGGTCTTCCTGGTGGGG - Intergenic
1201148494 Y:11080956-11080978 GGCACAGGGTCTGCCTGTAATGG + Intergenic