ID: 1020210706

View in Genome Browser
Species Human (GRCh38)
Location 7:6156146-6156168
Sequence ATCTCTTGAAACTGAAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020210704_1020210706 25 Left 1020210704 7:6156098-6156120 CCATGATGAGATGGATGAGCAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1020210706 7:6156146-6156168 ATCTCTTGAAACTGAAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020210706 Original CRISPR ATCTCTTGAAACTGAAACCC TGG Intronic
No off target data available for this crispr