ID: 1020210850

View in Genome Browser
Species Human (GRCh38)
Location 7:6157215-6157237
Sequence GTGCAACGGAACCACACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020210850_1020210852 4 Left 1020210850 7:6157215-6157237 CCTGCAGTGTGGTTCCGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1020210852 7:6157242-6157264 AAGCCCTTAGCGTTTATTGAAGG 0: 1
1: 0
2: 0
3: 2
4: 70
1020210850_1020210858 27 Left 1020210850 7:6157215-6157237 CCTGCAGTGTGGTTCCGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1020210858 7:6157265-6157287 CCTAAGTGACACAGGACTGAGGG 0: 1
1: 0
2: 1
3: 8
4: 146
1020210850_1020210856 26 Left 1020210850 7:6157215-6157237 CCTGCAGTGTGGTTCCGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1020210856 7:6157264-6157286 GCCTAAGTGACACAGGACTGAGG 0: 1
1: 0
2: 2
3: 14
4: 139
1020210850_1020210855 19 Left 1020210850 7:6157215-6157237 CCTGCAGTGTGGTTCCGTTGCAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1020210855 7:6157257-6157279 ATTGAAGGCCTAAGTGACACAGG 0: 1
1: 0
2: 1
3: 4
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020210850 Original CRISPR GTGCAACGGAACCACACTGC AGG (reversed) Intronic
915538206 1:156550420-156550442 GCCCAAGGGAACCAAACTGCAGG + Intronic
916712890 1:167427553-167427575 GTCCCACGAAACCACACTGAGGG - Intergenic
1063139233 10:3241689-3241711 GTGCTGCGGGACCACAGTGCGGG + Intergenic
1063775629 10:9260530-9260552 GTGCAATGGAACCACATTCTAGG - Intergenic
1073543891 10:104333458-104333480 GTGAAACGGAAGCACCCTGCAGG - Exonic
1073784708 10:106876485-106876507 GTGAAATGAAAGCACACTGCTGG + Intronic
1076006980 10:126955737-126955759 GTGCAACGTGACCACTCGGCAGG - Intronic
1080298243 11:30754523-30754545 GTGCCAGGGGAACACACTGCTGG - Intergenic
1081940858 11:46940328-46940350 TTGCAAAGGAACAAAACTGCAGG - Intronic
1092865709 12:12759034-12759056 GTCCAGCTGAACCACACTGTAGG - Intronic
1103524865 12:121560924-121560946 CTGCAAGGGATCCACACTGCTGG + Intronic
1109092204 13:58062256-58062278 GTGAAAGGTGACCACACTGCTGG + Intergenic
1113631336 13:111886773-111886795 GAGCAATGGGAACACACTGCTGG + Intergenic
1114870750 14:26654842-26654864 GTGAAATGGAAACACAATGCAGG - Intergenic
1117535855 14:56702765-56702787 TAGCAACGGGGCCACACTGCAGG - Intronic
1119339798 14:73867256-73867278 ATTCACTGGAACCACACTGCTGG + Intronic
1121229915 14:92349774-92349796 AAACAACTGAACCACACTGCTGG - Intronic
1121593024 14:95134725-95134747 GTGCAGGGGCACCCCACTGCCGG + Intronic
1122952144 14:105050928-105050950 GTGCACAGGAACCACATTGCTGG + Exonic
1136048107 16:27631481-27631503 GTGCAACTGTAGCTCACTGCGGG - Intronic
1137607071 16:49793926-49793948 GGGCTACAGAACCCCACTGCTGG - Intronic
1141842665 16:86584102-86584124 GTGGAAAGGAGCCACAGTGCTGG + Intergenic
1150314230 17:64155303-64155325 GTGCAGCGGAGCCACACGGGAGG + Intronic
1155058473 18:22206317-22206339 GTGCTCTGGAGCCACACTGCAGG - Intergenic
1160125223 18:76165586-76165608 GTGTCACGGAGCCCCACTGCTGG + Intergenic
1161406668 19:4094863-4094885 GTGGAACGGCACCGCACTCCTGG - Intronic
1168376066 19:55880631-55880653 GTGCAACTGTCCCACACTGTTGG - Intronic
927465977 2:23336766-23336788 CTGCATTGGAAACACACTGCAGG + Intergenic
928422597 2:31150510-31150532 GTGCAAAAGAAGCACAGTGCTGG + Intronic
936162396 2:110094510-110094532 GGGCACCGGGACCCCACTGCAGG - Intronic
936182264 2:110276856-110276878 GGGCACCGGGACCCCACTGCAGG + Intergenic
940026788 2:149216878-149216900 GTGCAAAGGAAACAAACTTCTGG + Intergenic
1171978012 20:31607585-31607607 GGGCCACAGAACCACACTGTGGG + Intergenic
1174373174 20:50107828-50107850 ATGCAACGAAACAACACTTCAGG + Intronic
1174765498 20:53249818-53249840 GTGCAACAGAAAGACACTGCAGG + Intronic
954798383 3:53172947-53172969 GAGCCAGGGAACCTCACTGCAGG + Intronic
957469627 3:80641657-80641679 GTGCATGGTAACCACACTACGGG - Intergenic
962101419 3:132346702-132346724 TTGCAACTGAGTCACACTGCTGG - Intronic
963413903 3:144969722-144969744 GAGGAACAGAACCACACAGCAGG + Intergenic
967981788 3:195070143-195070165 GTGCAGGGGAACCAGCCTGCCGG + Intronic
969523459 4:7692234-7692256 GTGCCACGTGACCGCACTGCTGG + Intronic
976942367 4:90719074-90719096 TTGGAACTGAGCCACACTGCAGG + Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
990831507 5:59964014-59964036 GTGGAAGGGAAACACATTGCAGG + Intronic
1009280175 6:61740107-61740129 GTGCTATGGAAGCACACTGGAGG + Intronic
1020210850 7:6157215-6157237 GTGCAACGGAACCACACTGCAGG - Intronic
1027167770 7:75847764-75847786 GTGCCAAGGAGCCACACTGGCGG + Intronic
1027774315 7:82444527-82444549 GTCCAATGGAACCACAGGGCTGG - Intergenic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040359991 8:46655994-46656016 TTGCTACGGAACCCCACTGAAGG - Intergenic
1048843663 8:138586420-138586442 GAGCAACAGAAACTCACTGCTGG + Intergenic
1049086679 8:140483835-140483857 GTGAAACGGACTCACACAGCAGG + Intergenic
1058655608 9:107217821-107217843 GTACAACGGAGGCACACTGAGGG - Intergenic
1060375001 9:123109623-123109645 GTGCGAAGGAGCCACAGTGCGGG + Intronic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic