ID: 1020211067

View in Genome Browser
Species Human (GRCh38)
Location 7:6158597-6158619
Sequence CTGTTTCCCCAGCACTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 183}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020211067_1020211071 -6 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211071 7:6158614-6158636 AAACAGCCGGAGATGAGGACAGG 0: 1
1: 0
2: 0
3: 9
4: 192
1020211067_1020211080 30 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211080 7:6158650-6158672 GGTGAGGACGGGTTGCCTGCGGG 0: 1
1: 0
2: 1
3: 7
4: 123
1020211067_1020211075 18 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211075 7:6158638-6158660 ACCAGCACTGCCGGTGAGGACGG 0: 1
1: 0
2: 0
3: 13
4: 149
1020211067_1020211079 29 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211079 7:6158649-6158671 CGGTGAGGACGGGTTGCCTGCGG 0: 1
1: 0
2: 1
3: 6
4: 138
1020211067_1020211074 14 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211074 7:6158634-6158656 AGGCACCAGCACTGCCGGTGAGG 0: 1
1: 0
2: 0
3: 19
4: 167
1020211067_1020211077 19 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211077 7:6158639-6158661 CCAGCACTGCCGGTGAGGACGGG 0: 1
1: 0
2: 5
3: 14
4: 187
1020211067_1020211073 9 Left 1020211067 7:6158597-6158619 CCCATGGAGTGCTGGGGAAACAG 0: 1
1: 0
2: 2
3: 15
4: 183
Right 1020211073 7:6158629-6158651 AGGACAGGCACCAGCACTGCCGG 0: 1
1: 0
2: 4
3: 27
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020211067 Original CRISPR CTGTTTCCCCAGCACTCCAT GGG (reversed) Intronic
900431828 1:2606356-2606378 CTGTCTCCCCAGGACTCGAGTGG - Exonic
900536307 1:3179408-3179430 CTGTTTCCCCAGCTGTACAGTGG + Intronic
902645381 1:17794116-17794138 CTATTTCCCCATCTGTCCATAGG - Intronic
902972460 1:20063747-20063769 CTGTTTCTCCATCAATACATTGG - Intronic
904243255 1:29165662-29165684 CTGTTTCCAGAGCAAGCCATGGG - Intronic
904364210 1:30000095-30000117 CTGTCTCCCCAGCTCTACAGTGG + Intergenic
905093129 1:35445871-35445893 CAGATTCACCAGCACTGCATAGG - Intronic
905360793 1:37418895-37418917 TTGTTTCCCCAGCACTCATAGGG - Intergenic
905851110 1:41275849-41275871 CTTCTTCCCCATAACTCCATGGG + Intergenic
906625798 1:47324449-47324471 CTGTAATCCCAGCACTCCTTGGG - Intergenic
907993559 1:59606952-59606974 TTGTGTCCCCAGCACCCAATAGG + Intronic
908809198 1:67962191-67962213 CTGTGGCCCAAGCTCTCCATGGG - Intergenic
911380729 1:97110909-97110931 CTGTAATCCCAGCACTTCATAGG + Intronic
912885322 1:113465455-113465477 CTTTTTGCCCAGCATTCCTTTGG + Intronic
913276709 1:117145385-117145407 CTTTTTCCCCAGCAACCCATGGG - Intronic
913480334 1:119282061-119282083 CTGTCACCTAAGCACTCCATGGG + Intergenic
915078847 1:153337453-153337475 CTAGTTTACCAGCACTCCATTGG - Intronic
915079522 1:153342298-153342320 TGGTTTCCCCAGCACTCCAGAGG - Intronic
915440063 1:155940368-155940390 CTCTTCCCTCAGCACTCCAAAGG + Intergenic
915639903 1:157216436-157216458 CTGTTTTCCTTGCTCTCCATGGG + Intergenic
916031488 1:160881227-160881249 CTGTTTCTCCAGTGCTGCATGGG + Exonic
917648600 1:177053061-177053083 CTGTGTCTCCAGCACTGTATGGG - Intronic
918231003 1:182531809-182531831 CTGTTTGCCAAGCATTGCATTGG + Intronic
918705140 1:187651107-187651129 CTGTAATCCCAGCACTCCAGAGG + Intergenic
919778354 1:201208121-201208143 CTGTCACCCCAGGACTCCCTAGG - Exonic
920246759 1:204593590-204593612 CTCTTCCCCCAGCTCTTCATGGG - Intergenic
920274219 1:204792009-204792031 CTGTTTCCCCAGCACCCTCAGGG - Intergenic
922116841 1:222621432-222621454 CTGTGTCCCCAGCAGGCCTTGGG + Intronic
1063389758 10:5641585-5641607 CTGTTGCCCCAGCTCTCCCTGGG - Intronic
1063644114 10:7861218-7861240 CTGTAATCCCAGCACTCCAGAGG - Intronic
1063933673 10:11054970-11054992 CTGTAATCCCAGCACTCCAGGGG - Intronic
1067792637 10:49299535-49299557 CTACTTCCCCAGCACAGCATCGG - Intronic
1067808154 10:49407488-49407510 CTGTTTCCCCTGTGCTCCCTCGG - Intergenic
1067935566 10:50609456-50609478 CTGTGTCACCAGTACTCCACAGG + Intronic
1070557499 10:77539817-77539839 CTGCTTCCCCAGCAATGCAAAGG - Intronic
1070889428 10:79930978-79931000 CTGGTTCCCAAGCACCCCAAGGG + Intergenic
1074048944 10:109865475-109865497 CTGTTTCCCCGGAAATACATAGG + Intronic
1074249352 10:111729012-111729034 GTGCTTCCCCAGCACACCCTGGG + Intergenic
1074363516 10:112840555-112840577 CTGCTTCCCTAGCACTCAACAGG + Intergenic
1075097180 10:119480030-119480052 CTGTTTCCCCAGCACTCTGAAGG + Intergenic
1079480389 11:20873801-20873823 CTGTTGCCCAGGCAGTCCATCGG + Intronic
1081634971 11:44714971-44714993 CTGTCTCCCCACCCCTCCATAGG - Intergenic
1081699108 11:45141550-45141572 CTGTTTCTCCAGCCTTCCAGAGG - Intronic
1083147721 11:60771438-60771460 CTCATTCCCCAGCACTTCAGGGG + Intronic
1083224202 11:61274270-61274292 CTGTGTCCCCAGCACACAGTAGG + Intronic
1084511350 11:69606279-69606301 CTGTGTCCCCAGGAATTCATGGG - Intergenic
1084689948 11:70719367-70719389 CTGCTGCCCCAGCACTCCTGGGG + Intronic
1085203030 11:74713207-74713229 CTGCTACCCCAGCACTGCCTGGG + Intronic
1086257939 11:84902157-84902179 TTGTTTCTCCAGCACTCCATGGG + Intronic
1086770152 11:90752315-90752337 CTGTTTCTCCACCACACCAGAGG - Intergenic
1087182672 11:95155176-95155198 CTGTTTTTCCAGCAAGCCATTGG - Intergenic
1087913728 11:103783114-103783136 CTTTTCCCCCAGCACTTCTTGGG + Intergenic
1088335423 11:108698625-108698647 CTGTTTCCCAGGCACCCCTTAGG + Intronic
1090857593 11:130623835-130623857 ATGTTACCCCAGGACTCCAGGGG + Intergenic
1094857800 12:34422582-34422604 GTGTTTCCAAAGCACTCGATTGG + Intergenic
1095982158 12:47979894-47979916 CTGTTTTCCCAGCCCTGCGTTGG - Intronic
1096436998 12:51600920-51600942 CTGGTTCCACAGCAAACCATGGG - Intronic
1098332671 12:69370746-69370768 CTTTTTCCCCAGCATTGCATTGG - Exonic
1103910822 12:124351143-124351165 CTGTGTCCCCACCACTGCGTGGG + Intronic
1104024181 12:125014150-125014172 CTGTTTACCTGGCACACCATGGG - Intronic
1105541526 13:21320810-21320832 CAGTTTCCACAGCAATCCTTTGG - Intergenic
1106226161 13:27788881-27788903 GTGTATCCCCAGCCCTCCACTGG - Intergenic
1107433937 13:40365252-40365274 CTGTAATCCCAGCACTCCAGAGG - Intergenic
1108412278 13:50161742-50161764 CTGTTTCACCTACATTCCATTGG + Intronic
1112347818 13:98606490-98606512 CTGTTGCCACAGCATTCCAAGGG - Intergenic
1112690886 13:101892678-101892700 CTGTTTTCCCAGCACACTATGGG - Intronic
1116716497 14:48432581-48432603 CTGTATTCCCAGCACTCAAGAGG - Intergenic
1118777932 14:68985432-68985454 CTGTTTCTCCATCAATCCATGGG + Intergenic
1119876778 14:78066549-78066571 CTCTTTCCCCTCCCCTCCATGGG + Intergenic
1121426698 14:93857300-93857322 CTGTTTCCCAAGAAGTCCCTTGG + Intergenic
1122083126 14:99280673-99280695 CTGTATGCCAAGCACACCATGGG + Intergenic
1122959701 14:105088715-105088737 CTGTTTCCCCATCTCTGCAAAGG + Intergenic
1127965704 15:63921365-63921387 CTGTTTCCTCAGCTCTAAATTGG + Intronic
1128927087 15:71666921-71666943 CTCTTCCCCCAGCTCTACATAGG - Intronic
1130449283 15:84034531-84034553 CTGTGTCCTCAGCATTCTATAGG - Intronic
1131238843 15:90720838-90720860 CTGTAGTCCCAGCACTCCGTGGG - Intronic
1131534179 15:93220639-93220661 CTCTTTCCCCACCAGCCCATAGG + Intergenic
1132784504 16:1648279-1648301 TTGTTTCCAGAGCACTTCATTGG + Intronic
1135563813 16:23496563-23496585 CTGTAATCCCAGCACTTCATGGG + Intronic
1136266395 16:29121895-29121917 CTGTGTCCCCAGCACACCTGTGG + Intergenic
1136335069 16:29605680-29605702 CAGTTTCCCCAGCTCTAAATTGG + Intergenic
1136468398 16:30461325-30461347 CTGTAACCCCAGCACTACTTTGG + Intergenic
1142183628 16:88684171-88684193 CTGTCTCCCCAGAACTCTCTTGG - Intronic
1143852029 17:9820241-9820263 CTGTTTCCACAGCTCTATATAGG - Intronic
1144849822 17:18238409-18238431 CTGTCTCCCTAGCACCCCAGTGG - Intronic
1145000221 17:19299759-19299781 CTCTTTCACCAGCCCTGCATTGG + Intronic
1145934272 17:28705835-28705857 CGGATTCCCCAGCACTCCTAGGG + Intronic
1147217186 17:38907784-38907806 CAGTTTCCCCAGCCCTTTATGGG + Intronic
1151665555 17:75543385-75543407 CTGTTTCTCCAGGTCTCCAGTGG + Exonic
1151806299 17:76407655-76407677 CGGTTTCCCCTGCACTCCCAAGG - Intronic
1152030312 17:77838141-77838163 CTCTTTCCCCAGCACCACAAGGG + Intergenic
1153583662 18:6599857-6599879 CTTTTGCCCCAGCCCTCCAATGG - Intergenic
1163669781 19:18620682-18620704 CTGCGTCCCCAGGACTCCGTGGG - Exonic
1165015960 19:32880070-32880092 CTGTCTCCCCAGCACACCACAGG - Intronic
1165372314 19:35416733-35416755 CACTTTCCCCAGGACTCCAGGGG + Intergenic
1165746054 19:38229869-38229891 CTGTATCCCCAGCAGCCAATGGG - Intergenic
1166698512 19:44868039-44868061 CTGCTTCCCCCTCAATCCATGGG - Intronic
1166862842 19:45819678-45819700 CTGTGTCCCCAGCACTACCCAGG + Intronic
1167273045 19:48517210-48517232 CTGTTCCTCCAACACTGCATGGG + Intergenic
1168379726 19:55909841-55909863 CTTTTTCCCCAGGTATCCATGGG + Intronic
1168467848 19:56618622-56618644 CTGTTTCCCCACAACCCCACGGG - Intronic
925276396 2:2651214-2651236 CTGTTTCTCCTGCAGGCCATGGG - Intergenic
927467236 2:23346653-23346675 CTGTGTCCCCAGCACCCAGTGGG - Intergenic
928089169 2:28363633-28363655 ATGTTTCCCCAGCAGCCCGTGGG + Intergenic
928123723 2:28602178-28602200 CTGTTCCCTCACCACTACATGGG + Intronic
929322329 2:40559214-40559236 TTGTTTCCACAGCACTCAATTGG + Intronic
929537091 2:42790501-42790523 CAGGTTCCCCAGCACCCCTTAGG - Intronic
929996327 2:46828389-46828411 CTGTGTCCCCAGCTCTCTCTGGG + Intronic
930766303 2:55089153-55089175 CTGTAATCCCAGCACTCCTTAGG - Intronic
931667937 2:64623612-64623634 CTGTGTTCCAAGCACTCCATGGG - Intergenic
931704244 2:64934038-64934060 CTGGTTGACCAGCACTCCCTGGG - Intergenic
932320066 2:70815492-70815514 CTTTTTACCCAGCACACCACTGG + Intronic
932869082 2:75378674-75378696 CTGTTTCCCCAGTAGGCCATTGG + Intergenic
933205024 2:79497248-79497270 CTGTTTCCCCAGCACGGCCCTGG + Intronic
934640062 2:96022573-96022595 CTATGTCCCCATCACTCCACAGG - Intronic
934793588 2:97082831-97082853 CTATGTCCCCATCACTCCACAGG + Intergenic
936146067 2:109981345-109981367 CCGTTGCCCCAGCTCTCCATAGG - Intergenic
936198623 2:110390134-110390156 CCGTTGCCCCAGCTCTCCATAGG + Intergenic
936242803 2:110802470-110802492 CTGTTTTCCCACCTCCCCATGGG + Intronic
941651235 2:168094699-168094721 CTGTTCCCCCAGGACTCCCCAGG + Intronic
942973509 2:181985884-181985906 CTGTTCCCCCACCAATCCCTTGG - Exonic
944636238 2:201678520-201678542 CTATTTCACCAGCACCCCACTGG - Intronic
1168994268 20:2121004-2121026 CTCTTTCCCCAGAAATCCTTGGG - Intronic
1169857071 20:10114309-10114331 TTGTTTTCCCAGAACTCCCTGGG - Intergenic
1171149694 20:22816279-22816301 TTGTTTCCTCAACTCTCCATAGG - Intergenic
1172727774 20:37059626-37059648 CTCTTTCCCCAACACTGCTTAGG + Intronic
1174561340 20:51432674-51432696 CTGGCTCCCCAGGCCTCCATGGG + Exonic
1177926446 21:27221955-27221977 CTGTAATCCCAGCACTCCAGAGG + Intergenic
1179295173 21:40055184-40055206 CTGTTTCCCCAGCAGCACTTTGG - Intronic
1183563598 22:38596419-38596441 CTGTAATCCCAGCACTCCAGAGG + Intronic
1183784759 22:40022948-40022970 CTAATTCCCCAGCACTGCTTTGG + Intronic
1183991248 22:41598427-41598449 CAGTTTTCCCAGAGCTCCATGGG - Exonic
1184523167 22:45007626-45007648 CGGTGCCCCCAGCACGCCATTGG + Intronic
949348299 3:3097869-3097891 CTGTTTGCCCTTCACGCCATTGG - Exonic
949732272 3:7127307-7127329 CTGTTTCCTGAACACTTCATTGG - Intronic
952686163 3:36150831-36150853 CTTTTTCCTCAGTTCTCCATAGG + Intergenic
954416112 3:50394238-50394260 CTCCATCCCCAGCACTCCCTGGG + Intronic
956732823 3:72212407-72212429 CTGTGTACTCAGCACTCCAAGGG - Intergenic
961616630 3:128187963-128187985 CTGCTTCACCAGCTCACCATTGG - Intronic
968342829 3:197972184-197972206 CTGTAATCCCAGCACTCCAGAGG - Intronic
968939285 4:3629736-3629758 CAGTTTCCCCAGCAGTAAATGGG - Intergenic
969702015 4:8772959-8772981 CAGTTTCCCCATCTCTACATGGG + Intergenic
970250324 4:14108342-14108364 ATGTTTCCCCAGCATTGCCTTGG + Intergenic
974469944 4:62305743-62305765 CTGCTTTCCCTGCACCCCATTGG - Intergenic
976815869 4:89148320-89148342 CTGTCTCCCCAGTCATCCATGGG + Intergenic
979961920 4:127030698-127030720 CTGTTGCCACAGCACTCAACTGG - Intergenic
984001277 4:174248935-174248957 GTGTTTTCCCTGGACTCCATTGG - Intronic
985570268 5:640990-641012 CTGTAGCCCCAGCTCACCATGGG - Intronic
990169545 5:53032856-53032878 CAGCTTCCCCACCACTCCCTGGG + Intronic
991603655 5:68378857-68378879 CTGCTTCCCCAGCTCTTCTTGGG - Intergenic
992863657 5:80937110-80937132 CTGTCTCCCCAGCTCTGCCTGGG + Intergenic
992937171 5:81719789-81719811 CTGTTTACCCTGCCCTGCATTGG - Intronic
996738170 5:126776602-126776624 CCGTTTCCCGAGCCCTCCAGCGG + Intronic
997594166 5:135095186-135095208 CAGTTACCCCAGCACTCCATGGG - Intronic
999701481 5:154232471-154232493 CTGTTCCCCCACCACCCCACTGG - Intronic
1000078148 5:157814771-157814793 CTGTAACCCCAGCACTTCCTGGG + Intronic
1004020281 6:11770623-11770645 CTGTTGCCCCACCCCTCCCTGGG - Intronic
1007305842 6:40903884-40903906 CTTTTTCCCCTGTACTTCATTGG + Intergenic
1007427495 6:41756910-41756932 CTGAATCCCCAGCCCTCCAAGGG + Intergenic
1009235736 6:61121577-61121599 CTGCATCCCCACCAGTCCATGGG - Intergenic
1011995162 6:93577488-93577510 CTCTTGCCTCTGCACTCCATAGG - Intergenic
1012334586 6:98039565-98039587 CTTTTGCCTCAGCACTCCCTTGG - Intergenic
1014910215 6:127083426-127083448 CTGTTGCGCCAGTACTCTATTGG + Intergenic
1018867176 6:167755340-167755362 CAGCTACTCCAGCACTCCATGGG - Intergenic
1019507415 7:1399276-1399298 CTGCTTCCCCAGGTCTCCAGGGG + Intergenic
1019852934 7:3577443-3577465 CTGTTGCCCCTGGACTTCATGGG + Intronic
1020192608 7:6011712-6011734 CTGTTTCCACGGCACTCTCTAGG - Intronic
1020211067 7:6158597-6158619 CTGTTTCCCCAGCACTCCATGGG - Intronic
1020853604 7:13389381-13389403 CTGTCACCTCAGCATTCCATTGG - Intergenic
1023110544 7:36806568-36806590 CTATTTCCCCAGCATCCCAGAGG - Intergenic
1028831214 7:95328288-95328310 CTGTCTTCACAGCACTCCATAGG + Intergenic
1029318848 7:99739397-99739419 CTGTTTCCTCATCTGTCCATGGG + Intergenic
1029323792 7:99788386-99788408 CTGTTTCCTCATCTGTCCATGGG + Intergenic
1029462608 7:100705262-100705284 CTGTTTGCCCAGCATTCAAATGG - Intergenic
1029716648 7:102331719-102331741 CTGTTTCCACGGCACTCTCTAGG + Intergenic
1031051467 7:116950152-116950174 CTGTAATCCCAGCACTCCTTGGG - Intergenic
1031766093 7:125779548-125779570 ATGTGTCCCCAGCACTCTTTGGG + Intergenic
1033261382 7:139846833-139846855 CTCTGTCCCCACCACACCATTGG - Intronic
1036221829 8:6927843-6927865 CTCTTTCCCCAGTAGTTCATGGG + Intergenic
1036508276 8:9376455-9376477 CATTTTCTCCAGCACTCCAATGG - Intergenic
1037935360 8:22911914-22911936 CTGTTTCCCCAGCACTTGGCTGG + Intronic
1039901440 8:41755600-41755622 GTGTTGCCCCAGCCCCCCATAGG - Intronic
1047218863 8:122902426-122902448 CTGTTTCCTCAGCTGTACATTGG + Intronic
1047771389 8:128032893-128032915 CTCTTTTGCTAGCACTCCATTGG + Intergenic
1049027411 8:140004501-140004523 CAGTTTCCCCAGTCCTCCAATGG + Intronic
1050056221 9:1658206-1658228 CTGATTCCCTAGCATTCCACAGG - Intergenic
1051116356 9:13698317-13698339 CTGATTCCCAACCACTCCAGGGG - Intergenic
1055732418 9:79292046-79292068 CTCTGTTACCAGCACTCCATGGG - Intergenic
1057302611 9:93895567-93895589 CGGTTTCCCCATCTGTCCATGGG + Intergenic
1058989519 9:110241666-110241688 TTCCTTCCCCATCACTCCATAGG + Intergenic
1060210295 9:121706321-121706343 CTGTTTTCCCACCCCTCCAGGGG + Intronic
1186919298 X:14260480-14260502 CAGTTTTCCCAACACTACATAGG + Intergenic
1187187247 X:16998647-16998669 CTGTTCCTCCAGCCCTCCAAAGG - Intronic
1187232609 X:17436856-17436878 CTGTTTCCCCAGCTGTCAAATGG - Intronic
1188265004 X:28062450-28062472 CTTTTTCCCCAGGATTCCTTTGG + Intergenic
1192168734 X:68841610-68841632 CTGTTTCCCCACCAGGCCAAAGG - Exonic
1192185734 X:68945689-68945711 ATGTTCACCGAGCACTCCATTGG - Intergenic
1194824891 X:98549802-98549824 CTTTTTCCTCAGGACTCCCTTGG + Intergenic
1196287109 X:113895963-113895985 CTGTGTCCCCAGCAACCCGTCGG + Intergenic
1196853302 X:119959613-119959635 CTGTAAGCCCAGCACTTCATGGG - Intergenic
1199497587 X:148470490-148470512 ATGTTTCTCCTGCTCTCCATAGG - Intergenic