HTGT WGE

Individual CRISPR Summary

ID: 1020214250

 View in Genome Browser
Species Human (GRCh38)
Location 7:6177600-6177622
Sequence ATTACCGTATTATGGGATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 35}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214250_1020214257 7 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214257 7:6177630-6177652 TCCTCCCATGGACACGGGAGAGG 0: 1
1: 0
2: 2
3: 12
4: 162
1020214250_1020214261 13 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214261 7:6177636-6177658 CATGGACACGGGAGAGGAACCGG 0: 1
1: 0
2: 1
3: 20
4: 330
1020214250_1020214263 23 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214250_1020214255 1 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214255 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 3
3: 28
4: 311
1020214250_1020214262 22 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214262 7:6177645-6177667 GGGAGAGGAACCGGTTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1020214250_1020214253 -5 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214253 7:6177618-6177640 GTAATGCCTCTCTCCTCCCATGG 0: 1
1: 0
2: 0
3: 14
4: 187
1020214250_1020214256 2 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214256 7:6177625-6177647 CTCTCTCCTCCCATGGACACGGG 0: 1
1: 0
2: 1
3: 34
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214250 Original CRISPR ATTACCGTATTATGGGATCC TGG (reversed) Intronic