ID: 1020214254

View in Genome Browser
Species Human (GRCh38)
Location 7:6177624-6177646
Sequence CCGTGTCCATGGGAGGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 199}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214254_1020214268 27 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214254_1020214263 -1 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214254_1020214267 20 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49
1020214254_1020214265 8 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214254_1020214262 -2 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214262 7:6177645-6177667 GGGAGAGGAACCGGTTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1020214254_1020214266 19 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214254 Original CRISPR CCGTGTCCATGGGAGGAGAG AGG (reversed) Intronic
900109309 1:998858-998880 CCGCGGCCCTGGGAGGAGGGCGG + Intergenic
900344868 1:2205766-2205788 CCGCGCACATGGGAGGAGGGCGG - Intronic
901422434 1:9160246-9160268 ACGTGGCCAGGGGAGGAGGGTGG - Intergenic
903374288 1:22856139-22856161 CAGAGTCCCTGGGAGGAGAGGGG + Intronic
905277993 1:36831389-36831411 CCGTATGCATGGCAGGAGTGAGG - Intronic
905793409 1:40802278-40802300 CCGAGGCCAGGGGCGGAGAGGGG - Intronic
906267060 1:44440360-44440382 CAGTGTGCAAGGGTGGAGAGTGG + Intronic
908371634 1:63486254-63486276 AAGTGTTCATGGGAGGAAAGGGG + Intronic
909686400 1:78354071-78354093 CAGTGTCCTTGTGAGGAAAGAGG - Intronic
911094716 1:94045930-94045952 TCGGGTCCCTTGGAGGAGAGTGG + Intronic
912602001 1:110945428-110945450 CCGTCTCAAAGGAAGGAGAGAGG - Intergenic
913265127 1:117036006-117036028 AGGTGTCCATGTGAGCAGAGAGG - Intronic
913299953 1:117360268-117360290 ATGTTTCCATGGGAGGAGAGGGG - Intergenic
914239894 1:145846337-145846359 CTGTGTCCACTGGAGGGGAGAGG + Intronic
915163056 1:153933120-153933142 CCCTGTCCAAGGCAGGAGATGGG - Intronic
915166763 1:153952201-153952223 CCGTGTTCATGGCAGGTGGGAGG + Exonic
916174886 1:162030071-162030093 AACTGTCTATGGGAGGAGAGTGG + Intergenic
919205264 1:194414189-194414211 CAGTGACCATGGGATGACAGTGG - Intergenic
919857583 1:201716233-201716255 CCTTGACCATGGGATGAGACAGG - Intronic
920180199 1:204127750-204127772 CCTTGTGCAGGGGAGGAGGGAGG + Intergenic
922721120 1:227900746-227900768 CCGTGTCCATGGGGGGACCTGGG + Intergenic
923672963 1:236056735-236056757 CTGTGTCCCTGGGAGGGGAGTGG - Intronic
923715453 1:236421425-236421447 CTTTGGCCATGGGAGCAGAGTGG + Intronic
1063923207 10:10951802-10951824 CTGGGCCCATGGGAGGAGAAAGG - Intergenic
1063956238 10:11270257-11270279 CCGTGTCCACAGGTGGACAGAGG - Intronic
1065961546 10:30738023-30738045 CCGTGTCTTTGGGAGAACAGAGG + Intergenic
1067560519 10:47301420-47301442 CTGTGTCCAGGGAAGCAGAGTGG + Intronic
1069738943 10:70675198-70675220 CTGGGTCCATGGAAGGCGAGGGG - Intronic
1069903388 10:71718596-71718618 CATTGTCCAGGGTAGGAGAGAGG - Intronic
1070501398 10:77075993-77076015 CCTTCTCCATGAGAGGAGGGAGG - Intronic
1075599120 10:123754298-123754320 CTGTGTCCATGAGTGCAGAGGGG - Intronic
1076315251 10:129535242-129535264 CTGTGGCAATGGGAGGACAGAGG + Intronic
1077141932 11:1028570-1028592 CCATGACCAGGGGAGGAGAAAGG - Intronic
1077484757 11:2833567-2833589 CCGTGTCACTGGGAGGCAAGAGG + Intronic
1081868183 11:46371217-46371239 CCCTGTCTCTGGGTGGAGAGAGG + Intronic
1084153427 11:67301773-67301795 CCGTGGCCTGGGGAGGAGGGCGG - Exonic
1085739147 11:79064454-79064476 CTGTGTGCAGGGGAGCAGAGAGG - Intronic
1087261368 11:96016253-96016275 ACGTGTACATGGGGGGAGGGTGG + Intronic
1088423109 11:109670149-109670171 CCATGTACATGGGATCAGAGGGG + Intergenic
1088467715 11:110159314-110159336 GCGAGTCCAGGGGAGGAGAGTGG + Exonic
1090331021 11:125932374-125932396 CCGTGCCCATGTGAGGTGGGTGG - Intergenic
1090966825 11:131605984-131606006 CACTGTCCTTGGGAGCAGAGAGG - Intronic
1091327507 11:134701984-134702006 CAGTGTCCCTGGGTGAAGAGAGG + Intergenic
1091912497 12:4243397-4243419 CAGAAGCCATGGGAGGAGAGGGG - Intergenic
1092999231 12:13980194-13980216 CCGTGTGCATGTGAGGTTAGTGG + Intergenic
1096611777 12:52806795-52806817 CTCTGTCCATGGGAGGTGAGAGG + Exonic
1101010407 12:100443750-100443772 GTGTGTCCATGGGGGCAGAGAGG - Intergenic
1101052378 12:100876342-100876364 CCATGTCCAAGGGTGGAGTGGGG + Intronic
1106788487 13:33130391-33130413 ACCTGTGCATGGGAGGACAGAGG - Intronic
1106976390 13:35221877-35221899 ACATGTCCATGGGAGAAGAGCGG + Intronic
1118027060 14:61780152-61780174 CCTTGTCTAGGGGAGGAGGGTGG + Intronic
1122138454 14:99647862-99647884 CTGTGTCCTCTGGAGGAGAGAGG + Intronic
1122925062 14:104895664-104895686 CCGTGTGCATGGGAGTTGGGGGG - Exonic
1123505879 15:20941205-20941227 CAATGTCCATGGCAGGGGAGAGG + Intergenic
1123563111 15:21514911-21514933 CAATGTCCATGGCAGGGGAGAGG + Intergenic
1123599360 15:21952194-21952216 CAATGTCCATGGCAGGGGAGAGG + Intergenic
1124637929 15:31376767-31376789 CGGTGTCCATGAGGGAAGAGGGG + Exonic
1126536847 15:49775621-49775643 CGGTGGCCATGGGCGGTGAGCGG - Intergenic
1127425328 15:58850213-58850235 GTGTGTACATGGGAGGAGGGAGG + Intronic
1127798089 15:62455243-62455265 CAGTTTCCAGGTGAGGAGAGAGG + Intronic
1128749005 15:70135116-70135138 GGGTGTCCATGGGTGGAGAAGGG - Intergenic
1130031413 15:80317880-80317902 CCAGGGCCTTGGGAGGAGAGGGG - Intergenic
1130850109 15:87784582-87784604 CTGTGCCCATGGAAGGAAAGTGG - Intergenic
1202971464 15_KI270727v1_random:242045-242067 CAATGTCCATGGCAGGGGAGAGG + Intergenic
1132591622 16:728624-728646 CTGTGCCCACGGGAGAAGAGGGG - Intronic
1134036412 16:11034583-11034605 CCCTGTCCACGGGTGGACAGGGG + Intronic
1134167459 16:11941793-11941815 ACCTGTCCTTGGGAGGAGAGTGG - Intronic
1134183359 16:12064716-12064738 CCATTTCCATGGGAGGTGTGGGG + Intronic
1134416043 16:14044310-14044332 CAGCGTCCATGGGAAGACAGTGG + Intergenic
1135830351 16:25767450-25767472 CAGTTTCCATGGGAGGTGGGGGG + Intronic
1136367618 16:29816211-29816233 CCGTGTCCGGGTGTGGAGAGGGG + Exonic
1136933290 16:34437110-34437132 CCTTGTCCCTGGGATGAGGGCGG - Intergenic
1136971282 16:34974704-34974726 CCTTGTCCCTGGGATGAGGGCGG + Intergenic
1138280859 16:55771311-55771333 GCTTGTCCATGGGAAGAGTGGGG - Intergenic
1139857238 16:69990552-69990574 ACCTGTCCTTGGGAGGAGCGTGG - Intergenic
1140540822 16:75754970-75754992 CCATGTGCAAGGCAGGAGAGAGG + Intronic
1141078624 16:81031623-81031645 CCGTGGCCATGGGAGAGGTGTGG - Intronic
1142197479 16:88745413-88745435 CCCTATCCATGGCAGGGGAGGGG + Intronic
1142436446 16:90061735-90061757 CAGGGTACATGGGAGCAGAGTGG - Intronic
1143601356 17:7948273-7948295 CCTTGTGAATGGGAGGAGGGAGG - Exonic
1145308445 17:21688349-21688371 CCGACTCCATGGGAGCAGGGAGG + Intergenic
1146284417 17:31564936-31564958 CCGTGCCAAAGGGAGGAGGGAGG - Intergenic
1147161587 17:38572189-38572211 TCGTGTTCATGGGAGTTGAGAGG - Intronic
1148589684 17:48806510-48806532 CTGTGGACATCGGAGGAGAGGGG - Intronic
1150292932 17:63992131-63992153 CTGTGGGCATGGGAGAAGAGGGG + Intergenic
1151342565 17:73481247-73481269 CTGTGTCCCTCGGAGGAGGGGGG + Intronic
1151625622 17:75273673-75273695 CTGTGTTGATGGGAGCAGAGCGG - Intronic
1151723145 17:75869708-75869730 CGCTGTGCCTGGGAGGAGAGGGG + Intergenic
1152931498 17:83112345-83112367 CCGTGTCCCTAGGAGGAGTGTGG + Intergenic
1153800471 18:8663582-8663604 CAGTGGCCAAGGGAGGTGAGTGG + Intergenic
1153943936 18:10002469-10002491 CAGAGTCCATGGGGTGAGAGAGG - Intergenic
1153980081 18:10301285-10301307 CCATGTCCCGGTGAGGAGAGGGG + Intergenic
1154093028 18:11382250-11382272 CTCTGTGCATGGGGGGAGAGGGG + Intergenic
1155434221 18:25794563-25794585 CCATGGCCATGAGAGGAGTGTGG + Intergenic
1157968039 18:52231152-52231174 TGGTGGCCATGGGAGGAGGGAGG + Intergenic
1158016488 18:52790418-52790440 CAGTTTGCATGGGAAGAGAGAGG + Intronic
1158347763 18:56532940-56532962 ACGTCTCCATGGCAGGGGAGAGG + Intergenic
1162827076 19:13259569-13259591 CCGTGTCCACGGGAGAAGGCTGG - Exonic
1163645235 19:18485511-18485533 CCCTGGCCCTGGGAGGAGATGGG - Intronic
1163945668 19:20531213-20531235 CCGTGGAAAGGGGAGGAGAGAGG + Intergenic
1164712692 19:30368785-30368807 CCGGGTCCAAGGGAGGGGACTGG + Intronic
1165496071 19:36152439-36152461 GCGTGTCCTTGGGCGGAGAAGGG - Exonic
1166559297 19:43721072-43721094 CCATGAACATCGGAGGAGAGAGG + Intergenic
1167333284 19:48869245-48869267 CCGTAGGCAGGGGAGGAGAGCGG + Intergenic
1168523259 19:57069190-57069212 CCTTCTCCATGGGAGGAAAAGGG + Intergenic
925045592 2:771024-771046 CCTGGTCCCTGGGAGGAGGGGGG - Intergenic
926869435 2:17396670-17396692 ATGTTTCCATGGGAGAAGAGAGG + Intergenic
928204307 2:29273152-29273174 TCTGGGCCATGGGAGGAGAGTGG - Intronic
931808907 2:65834893-65834915 GCCTCACCATGGGAGGAGAGAGG + Intergenic
933354384 2:81195446-81195468 CAGTGTCCATGGGGGGCAAGGGG + Intergenic
946295687 2:218782022-218782044 CCGCGTCGCTGGGAGGAGCGAGG + Exonic
946410538 2:219513236-219513258 CCTTGTCCCCGGGAGGAAAGGGG - Intergenic
947352566 2:229261659-229261681 CTGTGTCCATGGGAGCAGGAGGG - Intronic
948929513 2:241123022-241123044 CTGAGAGCATGGGAGGAGAGGGG - Intronic
1169131677 20:3169061-3169083 ACGGGTCCAAGGGAGGAGGGTGG - Intronic
1169191936 20:3663324-3663346 CGGGGTCCAGGGGAAGAGAGGGG + Intronic
1170710922 20:18789872-18789894 CCCTTTCCAGGGGAGGAGTGAGG + Intergenic
1173170064 20:40716550-40716572 CTGTGTTCATAGGAGGAGATGGG + Intergenic
1175794697 20:61764417-61764439 CTGTATCCCTGGGAAGAGAGAGG + Intronic
1175967721 20:62667934-62667956 CAGGGTCCAGGGGAGGACAGGGG - Intronic
1176037356 20:63046197-63046219 CCGTGTCCTCTGGAGGGGAGCGG - Intergenic
1176075163 20:63245027-63245049 CCGTGCCCAGGAGAGGAGACAGG + Intronic
1176177124 20:63733976-63733998 CTGTGGCCATGGGAGAGGAGGGG + Intronic
1177705988 21:24705462-24705484 CCTTATCCATGGAAGCAGAGTGG + Intergenic
1179974767 21:44858398-44858420 CCTTGCCCACGGGAGCAGAGTGG - Intronic
1180060254 21:45381396-45381418 CAGCCTCCAGGGGAGGAGAGAGG + Intergenic
1181433876 22:22899196-22899218 GCCTCTGCATGGGAGGAGAGGGG + Intergenic
1181456507 22:23063030-23063052 CAGTGGACATGGGAGGACAGGGG + Intronic
1181897855 22:26126488-26126510 CCATGTCCATCACAGGAGAGAGG + Intergenic
1183213722 22:36466278-36466300 CCGAGACCGAGGGAGGAGAGGGG - Intergenic
1183591674 22:38782742-38782764 CTGTGACCACTGGAGGAGAGTGG + Exonic
1183780549 22:39996006-39996028 CTTTGACTATGGGAGGAGAGGGG - Intronic
1184566991 22:45298030-45298052 CCGTGTTCATGGGAGGAATGAGG + Intergenic
1184730476 22:46368713-46368735 CAGTGTTCTAGGGAGGAGAGGGG - Intronic
1184924242 22:47626114-47626136 CCCTGACCACGGGAGGAGGGAGG - Intergenic
1185345120 22:50307613-50307635 CCGTCTCCATGGCAGCAGCGCGG - Exonic
949551316 3:5114640-5114662 CCGTGGAAAGGGGAGGAGAGAGG + Intergenic
950529970 3:13547868-13547890 CCGAGTCCCAGGGTGGAGAGTGG + Intergenic
950681496 3:14588363-14588385 CAGTGTCCAGAGAAGGAGAGAGG - Intergenic
953914506 3:46909724-46909746 CAGTGGCCATGGGAGGACATGGG + Intergenic
954876245 3:53804875-53804897 CTGTGTCCAAGGGAGGAGGCGGG + Intronic
959379110 3:105620319-105620341 GCATGTCCATGGGAGGTGGGGGG - Intergenic
960046138 3:113200341-113200363 ACCTGTCCCAGGGAGGAGAGAGG - Intergenic
964525040 3:157608835-157608857 CTGTGTTCATGGCAGGGGAGTGG - Intronic
967269978 3:187725314-187725336 CCGTGTGCAGGTGAGCAGAGCGG - Intronic
968054963 3:195684266-195684288 CCCAGCCCATGGGAAGAGAGGGG - Intergenic
968100951 3:195965010-195965032 CCCAGCCCATGGGAGGAGAGGGG + Intergenic
968920600 4:3520439-3520461 GCGTGTCCCTGGTAGGAAAGAGG - Intronic
969516218 4:7649513-7649535 CCATGGCCCTGGGTGGAGAGGGG + Intronic
970581318 4:17476746-17476768 CTCTGTCCATGGGAGGAAACTGG - Intronic
975190698 4:71457801-71457823 TGGTATCCATGGGAGGAAAGGGG - Intronic
976205168 4:82617399-82617421 CAGGTTCCATGGGAGGGGAGTGG + Intergenic
976838251 4:89400944-89400966 CCTGGTGAATGGGAGGAGAGTGG + Intergenic
985061269 4:186081794-186081816 CCGTGGCCAGGGGAGGTCAGAGG + Intronic
985485570 5:146475-146497 CTGTGTGGAGGGGAGGAGAGAGG - Intronic
985502136 5:254905-254927 CCCAGCCCGTGGGAGGAGAGGGG - Intronic
985563999 5:606239-606261 CCGAGTGCCTGGGAGGACAGAGG + Intergenic
985734884 5:1573762-1573784 CCCAGCCCGTGGGAGGAGAGGGG + Intergenic
986073493 5:4311076-4311098 CCGTCTCCATGACAGGAGACAGG + Intergenic
990182354 5:53174997-53175019 AATTGTCTATGGGAGGAGAGAGG + Intergenic
990237845 5:53787046-53787068 CAGTCTGCATGGCAGGAGAGAGG + Intergenic
992090404 5:73311592-73311614 CTGGGTCCATGGGCGGAGGGCGG - Intergenic
995072619 5:107942044-107942066 CCCTGACCATGGGAGGCCAGGGG + Intronic
995224224 5:109686114-109686136 ACGTGGCCATGGAAGGAAAGTGG - Intergenic
995876686 5:116797447-116797469 CCAGGGCCTTGGGAGGAGAGAGG - Intergenic
995907197 5:117139646-117139668 CTGTGGATATGGGAGGAGAGAGG + Intergenic
998228490 5:140344787-140344809 CCCTGTCCATGGCAGGAGCCTGG - Intronic
999367686 5:151033649-151033671 CCATGGCCATGGGGGGAGGGGGG + Exonic
999388021 5:151169269-151169291 CCCTGTCCATGGGAGGGGAGGGG - Intergenic
999567484 5:152881016-152881038 CACTGTCCATTGGAGGAGATGGG - Intergenic
1000130274 5:158290557-158290579 GTGTGTCCAGGGGAGGAGAGAGG + Intergenic
1003145350 6:3505552-3505574 CGGTGTGCATGGGAGCAGAGCGG + Intergenic
1007224553 6:40303514-40303536 CCAGGGCCATGAGAGGAGAGAGG + Intergenic
1008482233 6:51997766-51997788 CCGATGACATGGGAGGAGAGTGG + Intronic
1019293047 7:259715-259737 CCGGATCCTGGGGAGGAGAGGGG - Exonic
1019614536 7:1953145-1953167 CCGTGTCCCTGGGACCAGGGTGG - Intronic
1019731628 7:2632328-2632350 CCGTGACCCTGGGAGAGGAGGGG - Intronic
1020214254 7:6177624-6177646 CCGTGTCCATGGGAGGAGAGAGG - Intronic
1022505819 7:30908175-30908197 CCGAGTCCATGGGAGGACCCAGG + Intergenic
1026514734 7:71058998-71059020 CCATGTCCATGGTAGATGAGAGG + Intergenic
1027503052 7:78979428-78979450 CCTTGTCCCTGGGAGCACAGAGG - Intronic
1028626184 7:92880402-92880424 AGGTGTCCATGGCAGGAAAGTGG - Intergenic
1029550516 7:101234853-101234875 CCAGGTGCATGGGAGGAGTGGGG - Intronic
1031077233 7:117224795-117224817 CAGTGTCCCTGGAAGGAGACGGG - Intronic
1032518128 7:132522020-132522042 CTGTGTCCATGGGGAAAGAGAGG + Intronic
1034574357 7:151984636-151984658 CCTTGTGCATGGGAAGAGTGTGG + Intronic
1035028926 7:155844799-155844821 CCCAGGCCATGGGCGGAGAGGGG - Intergenic
1035357503 7:158285392-158285414 CCCTGTCCTTCTGAGGAGAGTGG - Intronic
1041178690 8:55225536-55225558 CTGTCTCCATAGGAGGAGAATGG - Intronic
1044256490 8:90069598-90069620 CTGTGACCCTGTGAGGAGAGAGG - Intronic
1047810384 8:128402455-128402477 TCGTGGCCATGGGAGGAAAATGG - Intergenic
1048345863 8:133573694-133573716 TTGTGTGCATGGGAGGAGGGGGG + Intergenic
1049328444 8:142037048-142037070 CCGTGTCCAGGGGCAGAGACAGG + Intergenic
1049590967 8:143462331-143462353 CTGTGACCATGGGTGGAGACTGG + Intronic
1049636064 8:143690096-143690118 CCATGTCCATGGGAACAGCGAGG - Exonic
1050181946 9:2932802-2932824 CCGTGCCCATGTGAGGTCAGAGG - Intergenic
1050926250 9:11267517-11267539 CACTTTCCTTGGGAGGAGAGTGG + Intergenic
1051329804 9:16012204-16012226 CTGTGGCCATGGGAGCAAAGTGG - Intronic
1054454618 9:65423540-65423562 CTGTGACCATGGCAGGGGAGGGG - Intergenic
1056011333 9:82333888-82333910 CAGTATCCAGGGGAGGACAGAGG - Intergenic
1056125916 9:83536886-83536908 CCATGTCAGTGGGAGGTGAGTGG - Intronic
1056722236 9:89082162-89082184 AAGTGTCCCTGAGAGGAGAGGGG - Intronic
1059740374 9:117144118-117144140 CTGTGTCCATAGAAAGAGAGTGG - Intronic
1060876732 9:127089266-127089288 CCGTCTCCATGGGTGGTGAGAGG + Intronic
1061411860 9:130426108-130426130 CTGTGTCCCTGTGAGGAGTGGGG - Intronic
1062043935 9:134416569-134416591 CAGTGTCCTTGGGAGGGGCGTGG + Intronic
1062206819 9:135342093-135342115 CCCTGTCCATGGTAGGAAAGAGG - Intergenic
1186030851 X:5367525-5367547 CCTTATCCATGGGAGAAGTGAGG - Intergenic
1189042671 X:37558877-37558899 CTGTCTCCATGGGAGGAAGGAGG + Intronic
1190558108 X:51658259-51658281 CCTTATCCATGGGAGCAGAGAGG + Intergenic
1190796054 X:53743502-53743524 GCGTGTCCATGGGAACAGTGTGG + Intergenic
1190927865 X:54924777-54924799 CCCAGACTATGGGAGGAGAGGGG - Intronic
1194665856 X:96676728-96676750 CTGTGTGCATGGCAGGGGAGGGG + Intergenic
1196783386 X:119401887-119401909 AGGTGACCATGGGAGCAGAGAGG + Intronic
1196918211 X:120560991-120561013 CCCTCTCCCTGGGAGGGGAGAGG + Intronic
1200088952 X:153625562-153625584 CCGGGACCCAGGGAGGAGAGGGG - Intergenic