ID: 1020214258

View in Genome Browser
Species Human (GRCh38)
Location 7:6177631-6177653
Sequence TCCTCTCCCGTGTCCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214258_1020214268 20 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214258_1020214262 -9 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214262 7:6177645-6177667 GGGAGAGGAACCGGTTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1020214258_1020214263 -8 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214258_1020214265 1 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214258_1020214266 12 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1020214258_1020214267 13 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214258 Original CRISPR TCCTCTCCCGTGTCCATGGG AGG (reversed) Intronic