ID: 1020214258

View in Genome Browser
Species Human (GRCh38)
Location 7:6177631-6177653
Sequence TCCTCTCCCGTGTCCATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 116}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214258_1020214268 20 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214258_1020214265 1 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214258_1020214266 12 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1020214258_1020214263 -8 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214258_1020214262 -9 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214262 7:6177645-6177667 GGGAGAGGAACCGGTTGCACTGG 0: 1
1: 0
2: 0
3: 8
4: 122
1020214258_1020214267 13 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214258 Original CRISPR TCCTCTCCCGTGTCCATGGG AGG (reversed) Intronic
900618285 1:3575332-3575354 CCCCCTCCCCTGTCCCTGGGAGG - Intronic
901442259 1:9285592-9285614 TCCTCTTCTGTGGCCATGGCAGG + Intergenic
902312897 1:15595189-15595211 TCCTCTCTCCTGCCCATAGGAGG - Intergenic
903651156 1:24923211-24923233 TCCTCTCCTTTGTACCTGGGAGG - Intronic
906144153 1:43550176-43550198 TCCTCTCCAGCCTCCAAGGGAGG + Intronic
906478898 1:46187651-46187673 TCCTCTGCCGTGTGCCTGTGTGG + Intergenic
907771288 1:57467045-57467067 TCCTCCCCTTTGTGCATGGGTGG - Intronic
907782714 1:57582029-57582051 TCCTCTCTCTGTTCCATGGGAGG - Intronic
908474180 1:64471546-64471568 TCCCCTCCCGGGAGCATGGGGGG + Intronic
912926499 1:113917841-113917863 TCCTCTCCCATGTACATCAGTGG + Intergenic
916631425 1:166618300-166618322 TCAGCTCAAGTGTCCATGGGAGG + Intergenic
916679378 1:167090207-167090229 TTCTCTCCAGTGCCCAGGGGTGG - Intronic
917121047 1:171645145-171645167 TCCTGTCCTGCGTCCATAGGTGG + Intronic
918155802 1:181845372-181845394 GCCTCCCCTGTGTCCATGGCAGG - Intergenic
920334978 1:205239043-205239065 TCCTCTCCCCTATCCCCGGGAGG - Intronic
922721116 1:227900739-227900761 GGCATTCCCGTGTCCATGGGGGG + Intergenic
923268897 1:232337076-232337098 TCCACTCCTGTGTCCTTCGGGGG + Intergenic
924652906 1:245947027-245947049 TGCTCTTCCGTGGCCCTGGGAGG + Intronic
1070075760 10:73133497-73133519 CCCTCTCCAGTGACCAAGGGAGG - Intronic
1073007022 10:100332038-100332060 TCCTCTCCCATGTTCATTGCAGG + Intergenic
1074883037 10:117673168-117673190 CCCACTCACTTGTCCATGGGAGG + Intergenic
1076036139 10:127199921-127199943 TCCTCTCCAGTGTGCAAGGCAGG + Intronic
1077228926 11:1450136-1450158 TCCTGTGCCGTGTGCATGCGGGG + Intronic
1077911129 11:6571840-6571862 TCGTGTCCTGTGTACATGGGAGG + Exonic
1083637062 11:64126492-64126514 TCCTCTGCCGTGTTTATAGGGGG - Intronic
1084192888 11:67506822-67506844 TCCTGTCCTGTGTCCCTTGGTGG - Exonic
1084836971 11:71809365-71809387 TCCTCTCAGGTTTCCATGGGAGG - Intergenic
1090194191 11:124800578-124800600 TCCTCTCCCGGGGCGAAGGGCGG + Exonic
1090469687 11:126969255-126969277 TCATTCCCTGTGTCCATGGGAGG - Intronic
1092917742 12:13203438-13203460 TCCTCCTTCGTGTCCAGGGGAGG - Intronic
1095038649 12:37420105-37420127 TCCTCTCCTCTGTTCCTGGGTGG - Intergenic
1098986137 12:77014605-77014627 GCCTCTCCCGGGCCCCTGGGCGG + Intergenic
1101412563 12:104481581-104481603 TTCTCTCACGCGTCGATGGGGGG + Intronic
1103211419 12:119169737-119169759 TTCTCACCCGTGTCCATTGTGGG + Intergenic
1103793857 12:123490174-123490196 GCCTCTCCTGTGTCTCTGGGAGG + Intronic
1104736779 12:131139932-131139954 CCCTCTGCCCTGTCCTTGGGGGG + Exonic
1118916847 14:70114907-70114929 TCCTCTCCCGTGACCAGGCAGGG + Intronic
1119865831 14:77973077-77973099 ACCTCTCCCATGGCCTTGGGAGG + Intergenic
1122246985 14:100410302-100410324 TCCTCCACCGTCTCCCTGGGAGG - Intronic
1125487627 15:40123354-40123376 TCCTCCCCCATATCCAGGGGAGG + Intergenic
1125979634 15:43988715-43988737 TCCTCTCCCGTGTCCACACAGGG - Intronic
1127864353 15:63019744-63019766 TCATCTGCCGTGGCCCTGGGAGG - Intergenic
1128724141 15:69975389-69975411 GCCCCTGCCCTGTCCATGGGTGG + Intergenic
1129120120 15:73391214-73391236 TTCTCTCCAGTGTCCCTGGCTGG + Intergenic
1132615688 16:840247-840269 GCCTCTCCCGTGTCCCCAGGTGG + Intergenic
1132832520 16:1935744-1935766 TCCTCTCTCCTCTCCAGGGGTGG + Intergenic
1132925167 16:2425499-2425521 TCCTCCCCCGTGTGCATCTGTGG + Intergenic
1134134407 16:11669376-11669398 TCCTCTCCCGCGTGCCTGAGGGG - Intronic
1142071730 16:88094324-88094346 TCCTTCCCCGCGTCCACGGGCGG + Intronic
1148605876 17:48928495-48928517 TCCTCTCCCTTATGCATGGCTGG - Exonic
1149505958 17:57194143-57194165 TCCTCAGCCGTCTCCCTGGGAGG + Intergenic
1149583432 17:57767722-57767744 TGCTCTCCCCTGTACAAGGGTGG - Intergenic
1149623098 17:58060722-58060744 TCCTCTCCCTTTTCCCTTGGAGG + Intergenic
1152903978 17:82960592-82960614 CCCTCTCCCGTGTCACTGTGAGG - Intronic
1153277080 18:3378022-3378044 TCCTCTACTGTATCCATGTGTGG - Intergenic
1155680508 18:28481001-28481023 TCCTGCCCCGTGTCCCTCGGTGG + Intergenic
1157453000 18:47801915-47801937 TCCTGTCCAGTGTCTATGGCCGG + Intergenic
1160973544 19:1780909-1780931 TTCTCTCCCCTGTCCCTGGAGGG - Exonic
1163257863 19:16168408-16168430 TCCTGTCCAGGGACCATGGGAGG - Intronic
1165779327 19:38423082-38423104 TCTTCTCCCGAGTCCCTGGTAGG - Intronic
1165849912 19:38843719-38843741 GGCCCTCCCATGTCCATGGGGGG + Intronic
1166455738 19:42938329-42938351 TCCTCTCCTGTGTGCTTGCGGGG - Intronic
925265091 2:2561465-2561487 TCCTCTCCTGGGGCCTTGGGAGG + Intergenic
928059929 2:28101583-28101605 TCCTATCCCCAGTCCATGTGGGG + Intronic
930530309 2:52580985-52581007 TGCTCTCCCGTGGCCTTGGTTGG + Intergenic
931667761 2:64622679-64622701 CCCTCTCCAGTGTCCCTGGGTGG + Intergenic
932109270 2:68980117-68980139 TCCTCGCGCGTGTCCATAGTGGG + Intronic
934949317 2:98565623-98565645 CCCTCTCTCATGTCCAGGGGAGG + Exonic
937228557 2:120383782-120383804 TCATCTCCTGTGGCCCTGGGGGG + Intergenic
937779824 2:125824199-125824221 TCATCTCCTGTGTCCCAGGGGGG + Intergenic
938182057 2:129192363-129192385 TCCTCTCCCATCCGCATGGGTGG - Intergenic
940515873 2:154683563-154683585 TCCTCTCAACTGCCCATGGGAGG + Intergenic
941853402 2:170206722-170206744 CCCTCTCCCTTTTCCCTGGGTGG + Intronic
944910798 2:204308781-204308803 TCCTGTCCCTTGTCTTTGGGAGG - Intergenic
1173493806 20:43504623-43504645 TCTTCACCTGGGTCCATGGGTGG - Intergenic
1173957087 20:47041702-47041724 TCCCCTCCCGTGGTCATGGCAGG - Intronic
1176675966 21:9777820-9777842 TCCTCTCCCTTGTCTATGGTGGG - Intergenic
1185127026 22:49017021-49017043 TCCACTGCCGTGTCTAGGGGTGG + Intergenic
950083641 3:10240954-10240976 TCCTCTCCCCTCCCCATGGCAGG - Intronic
952142849 3:30498972-30498994 TCCTCTCCCATGTGCCTTGGAGG - Intergenic
954992324 3:54852163-54852185 GCCTCTCCAGTGTCCAGGAGTGG + Intronic
956610167 3:71114609-71114631 TCCACCCCCGTGTCCCAGGGAGG + Intronic
966217619 3:177519545-177519567 TCCTCACCTAGGTCCATGGGGGG - Intergenic
969265770 4:6063273-6063295 TCCTCTCTCATGGCCATGTGGGG - Intronic
969530974 4:7729972-7729994 TCTTCTCCCGTGTCATTGGCTGG + Intronic
972784418 4:42313826-42313848 TCCCCTCCCTTGTCCAAGTGTGG + Intergenic
973535425 4:51876980-51877002 TCCTCTTCCCTCTCCATGTGAGG + Intronic
977139110 4:93344383-93344405 TCCTCAACTGTGGCCATGGGTGG + Intronic
984646479 4:182225683-182225705 ACATCTCCCGTGTCCCTGGTTGG - Intronic
985399574 4:189580922-189580944 TCCTCTCCCTTGTCAATGGTGGG + Intergenic
985479058 5:95851-95873 ACCTCTCTAGTGTCCATTGGAGG + Intergenic
993766427 5:91864148-91864170 TTCTCTCCTGTGTCTGTGGGTGG + Intergenic
995203754 5:109455830-109455852 TCCTCTCCCTTCTCCCTGGCAGG - Intergenic
1001065883 5:168534814-168534836 TCCTCTCCCGTGGCCCAGGATGG - Intergenic
1007262773 6:40575403-40575425 TTCTTTCCTGTGTCCATGGAAGG - Intronic
1013587379 6:111591488-111591510 TCATATCCCGTGTCTATGGTTGG + Exonic
1014756778 6:125310055-125310077 TCTTCTCCCATGTCCAGGTGAGG + Intergenic
1015469396 6:133586770-133586792 TCTTCGCCAGTGTCCCTGGGAGG - Intergenic
1019503440 7:1377309-1377331 TCCCCTTCCGTGGCCATGGCAGG + Intergenic
1019524670 7:1475561-1475583 TCCTCTCCAGTGACCCTGGTGGG - Intronic
1020214258 7:6177631-6177653 TCCTCTCCCGTGTCCATGGGAGG - Intronic
1023254766 7:38302104-38302126 TCCTCTCCTGTCTCCTAGGGAGG - Intergenic
1029375051 7:100172072-100172094 TTCTCTCCCCTGTACCTGGGCGG + Exonic
1029419747 7:100466603-100466625 TCCTCTCCTCTGCCCAGGGGAGG - Exonic
1032059972 7:128716093-128716115 TCCTCTGCCTTCTCCTTGGGAGG + Intronic
1035810359 8:2486096-2486118 TCCTCTCTCCTGTCCATGCCTGG + Intergenic
1041163788 8:55071846-55071868 TCCCCTCATGTCTCCATGGGCGG + Intergenic
1042229862 8:66544521-66544543 TCCTACCCCGTGCCCGTGGGCGG - Intergenic
1043528146 8:81119048-81119070 TCCTGTCCCTTGTCAGTGGGAGG - Intergenic
1049439442 8:142602513-142602535 TCCCTTCCCATGTCCATGGCTGG - Intergenic
1049712641 8:144072790-144072812 TCATCCCACGTGTCCATCGGTGG - Intergenic
1051353108 9:16216831-16216853 TCCTCTCCCCTGTCCACGGCTGG - Intronic
1054160388 9:61668758-61668780 TCCTCTCCTGTGCTCCTGGGTGG - Intergenic
1058188677 9:101886994-101887016 TCCTCTCCCGTGGAGTTGGGAGG + Intergenic
1059329097 9:113523989-113524011 GCCTTTCCCCTGTCCATGGAAGG + Intronic
1061871938 9:133525566-133525588 TTCAGTCACGTGTCCATGGGTGG + Intronic
1061973275 9:134055991-134056013 TGCACTCCGGTGTCCATGGCTGG - Intronic
1062243637 9:135552481-135552503 TCATCTCCTGTGTCCAGGGTCGG - Intergenic
1190829672 X:54048513-54048535 TCCTCCCCAGTGTCCTTGAGAGG + Intronic
1193216364 X:78869018-78869040 GCCTCTGCCTTGTCCATTGGAGG + Intergenic
1196112330 X:111960348-111960370 TTCTCTCCAATGTCCAGGGGAGG + Intronic
1196422383 X:115536377-115536399 TTTTCTCCCAGGTCCATGGGAGG + Intergenic