ID: 1020214259

View in Genome Browser
Species Human (GRCh38)
Location 7:6177634-6177656
Sequence GGTTCCTCTCCCGTGTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214259_1020214268 17 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214259_1020214266 9 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1020214259_1020214265 -2 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214259_1020214267 10 Left 1020214259 7:6177634-6177656 CCCATGGACACGGGAGAGGAACC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214259 Original CRISPR GGTTCCTCTCCCGTGTCCAT GGG (reversed) Intronic
900402537 1:2478456-2478478 CGTGTCTCTCCCGTGTCCAGTGG + Exonic
902880276 1:19367625-19367647 AATACCTGTCCCGTGTCCATGGG - Intronic
905649422 1:39646584-39646606 GGTTCCCCTTCCCTGTCCCTGGG + Intergenic
908408789 1:63842738-63842760 GGTTCCTCTCCCTTTTCCCCTGG - Intronic
916877036 1:168980259-168980281 GTTTTCTCTCCCATGTCCTTGGG + Intergenic
1064196802 10:13250359-13250381 TGTTTCTCTGCCCTGTCCATCGG - Intergenic
1066275301 10:33862897-33862919 GGTTTCTCCCACGTGTCCCTCGG + Intergenic
1069671007 10:70203850-70203872 GGGTCCCCTCCAGTGTCCAGCGG + Intronic
1070955334 10:80459885-80459907 GGGTCCTCTCCTGTGTCCCTGGG + Intronic
1076143709 10:128099709-128099731 GGTTCCTCTCCCTTAGCCAAGGG - Intronic
1076243497 10:128928108-128928130 GGCTCCTCACCTGTGTCCACAGG + Intergenic
1083765712 11:64840497-64840519 GGGCCCTCTCCTGTGTCCCTAGG + Intronic
1083842828 11:65314709-65314731 GGTGCCGCTCCCGGGTCCAGCGG - Intergenic
1083932734 11:65854881-65854903 GGTTCCTCTCCCTTTTCCCCTGG - Exonic
1084192889 11:67506825-67506847 GCTTCCTGTCCTGTGTCCCTTGG - Exonic
1087692105 11:101332722-101332744 GTTTCCTTTGCTGTGTCCATGGG - Intergenic
1088725697 11:112632537-112632559 GGCTCCTCTCCCCTGGCCATCGG + Intergenic
1091282329 11:134389263-134389285 CCTTCCTCTTCCGTGTCAATAGG + Exonic
1092905088 12:13093681-13093703 GGTTCCTCTCCACTGACCAAGGG - Intronic
1096843895 12:54394999-54395021 GGTTCCTTTCCCTTCTCCCTTGG + Intergenic
1098949753 12:76627651-76627673 GTTTCCCCTCCCCTCTCCATTGG - Intergenic
1104389723 12:128381556-128381578 GCTTCCTCTCTCACGTCCATAGG - Intronic
1106146676 13:27055303-27055325 GGTTCCTGTCCCTTCTCAATGGG + Intergenic
1113249530 13:108436584-108436606 GTTCCCTCTCCTGTGTCCATGGG + Intergenic
1113461367 13:110484741-110484763 GAAGCCTCTCCTGTGTCCATCGG - Intronic
1122071482 14:99208196-99208218 GGATCCTGTCCCTTGTCCTTTGG + Intronic
1125414093 15:39434724-39434746 GGTTAGCCTCCCGTGTCGATAGG + Intergenic
1129159648 15:73740240-73740262 GCACCCTCTCCCGTGTCCCTGGG + Exonic
1131150535 15:90044790-90044812 GGCTCCTCTCCTGTGTGCATGGG + Intronic
1131733938 15:95312129-95312151 TGTTCCTTTCCCCTGTCCAGGGG - Intergenic
1138535602 16:57658686-57658708 GGTTCCTGTGCTGTGTCCTTGGG - Intronic
1138929092 16:61630636-61630658 GGTTCCTTTTCTGTCTCCATCGG + Intergenic
1145183240 17:20771460-20771482 GCTTCCTCGGCAGTGTCCATGGG + Intergenic
1145875671 17:28317128-28317150 GGTTACTCCCCCGTGTGCAGTGG + Intergenic
1152664656 17:81560327-81560349 GCTTCCCCTCCCGGGTTCATGGG - Intronic
1155680507 18:28480998-28481020 GCTTCCTGCCCCGTGTCCCTCGG + Intergenic
1156458282 18:37306952-37306974 GGCTCCTCTCCCCTCTCCCTGGG - Intronic
1156850213 18:41717440-41717462 TTTTCCTGTCCTGTGTCCATTGG + Intergenic
1159349353 18:67251779-67251801 GTTTCCCTTCCTGTGTCCATGGG + Intergenic
1160988885 19:1852586-1852608 GGCCCCTCTCCAGTGTCCAGGGG - Exonic
1161468570 19:4445366-4445388 GGCGCCCCTCCCGTGCCCATGGG + Exonic
1162336684 19:10065610-10065632 GGTGCCTCTCCCGTTGCCACTGG - Intergenic
1164750093 19:30647341-30647363 GGTGCTTCTCCCGTTTCCCTGGG + Intronic
1165198846 19:34129109-34129131 GGTTCCTCCCCCTTGTCCTGTGG - Intergenic
1165249699 19:34519948-34519970 TGTTCCTCTCCTGTGGCCAAAGG + Intergenic
1168579996 19:57547387-57547409 GGTTTCTCTCCAGTGTGGATTGG + Exonic
925667440 2:6275606-6275628 AGTTGCTCTTCCGTATCCATGGG + Intergenic
931259842 2:60607747-60607769 GTTTCCTCTCCCCTCACCATAGG + Intergenic
938095482 2:128458645-128458667 AGTTCTTCTCCAGTGCCCATGGG + Intergenic
939832529 2:147089847-147089869 GGATCCTCTTCCAAGTCCATTGG + Intergenic
942489712 2:176477101-176477123 GCTTCCTCTTCGGTGTCCCTAGG + Intergenic
944126626 2:196301062-196301084 TGTTCCCCGCCAGTGTCCATGGG + Intronic
947087478 2:226471661-226471683 GGCTCCTGCCCCGTGTCCACTGG - Intergenic
947822139 2:233079524-233079546 GCTTCCTCCCAGGTGTCCATGGG + Intronic
948186568 2:236026097-236026119 GGTGCCTCTGCCCTCTCCATGGG - Intronic
1175823870 20:61926085-61926107 GGTTTCTCTCCGGTCTCCTTGGG - Intronic
1181853087 22:25764037-25764059 GGTCCCTCTCCTGAGTCCCTTGG + Intronic
1183908083 22:41058011-41058033 CCCACCTCTCCCGTGTCCATGGG + Intergenic
1184963796 22:47951669-47951691 AGCTCCTCTTCAGTGTCCATAGG - Intergenic
1185162827 22:49239822-49239844 GGTTCCTTTCCCGTGTCCACTGG + Intergenic
950544583 3:13630815-13630837 GGTACCTCTCCCCTGTCCAAGGG + Exonic
952142850 3:30498975-30498997 GCTTCCTCTCCCATGTGCCTTGG - Intergenic
957961239 3:87256391-87256413 GCTTCCTCTCTCTGGTCCATAGG - Intergenic
964670991 3:159226200-159226222 AGTCCCTCTCCCGTCTCCAGAGG + Intronic
974019927 4:56683984-56684006 GGTTCCTCTCCTGGGTCTAAGGG + Intergenic
975615588 4:76243669-76243691 TGTTCCTCTGCCCTCTCCATAGG + Intronic
978501278 4:109412372-109412394 GTTTCCTCTCCCCTGTACCTAGG + Intergenic
978846855 4:113283361-113283383 GTTTCCTCTCTCCTATCCATAGG - Intronic
979707380 4:123736537-123736559 GGTTCCTTTCCCCTTTCCAGCGG - Intergenic
989131630 5:38112800-38112822 GCTTCCTCACCCATGTCCACTGG - Intergenic
991700549 5:69312915-69312937 GGTTCCTCTCCCTTTTCCCCTGG - Intronic
992136674 5:73752959-73752981 GGTTACTCTCCGGTGACCATGGG + Exonic
994578605 5:101611413-101611435 GCTCACTCTCCAGTGTCCATGGG - Intergenic
1000799965 5:165713569-165713591 GGCACCTCTCCCATGCCCATAGG + Intergenic
1001580723 5:172796501-172796523 GGATGCTCTCCCTTGTCCTTAGG + Intergenic
1003168346 6:3700798-3700820 GGTGCCTCACCCCTGTCCCTGGG - Intergenic
1007163002 6:39807904-39807926 AGTTCATCTCCCTTGACCATTGG + Intronic
1007661093 6:43486905-43486927 GGGTTCTCTCCCTTGTCCCTGGG + Intronic
1015315106 6:131808189-131808211 GGCTCCTCCCCCACGTCCATAGG - Exonic
1016997213 6:149969127-149969149 AGATCCTCTGCCGTGTCCATGGG - Exonic
1016998588 6:149978861-149978883 AGATCCTCTGCTGTGTCCATGGG - Intergenic
1017001589 6:150001064-150001086 AGATCCTCTGCCGTGTCCGTGGG + Intergenic
1020143146 7:5623258-5623280 GGAGCCACTCCCGTGTCCAGAGG - Intronic
1020214259 7:6177634-6177656 GGTTCCTCTCCCGTGTCCATGGG - Intronic
1020432212 7:8125921-8125943 GGTGCCTTTCCCGTGTATATGGG + Intronic
1042625845 8:70755715-70755737 GTTCCCCTTCCCGTGTCCATGGG - Intronic
1043655396 8:82659029-82659051 GGTTCAACTCCCTTGTTCATGGG + Intergenic
1046704165 8:117432451-117432473 CATTCCACTCCAGTGTCCATGGG + Intergenic
1048628225 8:136210651-136210673 GCTTCCTCTCCCATTGCCATAGG - Intergenic
1049712642 8:144072793-144072815 GATTCATCCCACGTGTCCATCGG - Intergenic
1060216966 9:121744226-121744248 GCTTCCACTCCCTAGTCCATGGG + Intronic
1061262234 9:129486785-129486807 GCTTCCTCTCCCGAGTCCTCTGG + Intergenic
1061911657 9:133728297-133728319 GGTACCTCCCCGGTGACCATAGG + Intronic
1190758577 X:53422067-53422089 GGTAGCTCTCCCGTGGCCTTCGG - Intronic
1192801934 X:74473984-74474006 GCTTCCTCAGCAGTGTCCATGGG + Intronic