ID: 1020214260

View in Genome Browser
Species Human (GRCh38)
Location 7:6177635-6177657
Sequence CGGTTCCTCTCCCGTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214260_1020214265 -3 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214260_1020214266 8 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1020214260_1020214268 16 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214260_1020214267 9 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214260 Original CRISPR CGGTTCCTCTCCCGTGTCCA TGG (reversed) Intronic