ID: 1020214260

View in Genome Browser
Species Human (GRCh38)
Location 7:6177635-6177657
Sequence CGGTTCCTCTCCCGTGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 71}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214260_1020214265 -3 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214265 7:6177655-6177677 CCGGTTGCACTGGGCTCGCTTGG 0: 1
1: 0
2: 1
3: 4
4: 47
1020214260_1020214268 16 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214268 7:6177674-6177696 TTGGTATTGAGACGGGCATGTGG 0: 1
1: 0
2: 1
3: 7
4: 93
1020214260_1020214266 8 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214266 7:6177666-6177688 GGGCTCGCTTGGTATTGAGACGG 0: 1
1: 0
2: 0
3: 2
4: 44
1020214260_1020214267 9 Left 1020214260 7:6177635-6177657 CCATGGACACGGGAGAGGAACCG 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1020214267 7:6177667-6177689 GGCTCGCTTGGTATTGAGACGGG 0: 1
1: 0
2: 0
3: 3
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214260 Original CRISPR CGGTTCCTCTCCCGTGTCCA TGG (reversed) Intronic
902875216 1:19336909-19336931 CAGCTCCTCTCATGTGTCCAAGG + Intergenic
915399654 1:155612915-155612937 GTGTTCCTCTCCAGTTTCCATGG + Exonic
915416766 1:155748471-155748493 GTGTTCCTCTCCAGTTTCCATGG + Intergenic
917536020 1:175875258-175875280 CCTTTCCTCTCCTGTTTCCATGG + Intergenic
918275768 1:182952879-182952901 CGCCGCCTCTCCCGTGTCCTCGG + Exonic
920204522 1:204281999-204282021 TGATTTCTCTCCCTTGTCCACGG - Intronic
920523746 1:206649682-206649704 CCTTTCCTCTCCCATGCCCAAGG + Intronic
1065318722 10:24488928-24488950 CAGTGCCTCTGCTGTGTCCACGG + Intronic
1070955333 10:80459884-80459906 AGGGTCCTCTCCTGTGTCCCTGG + Intronic
1072408050 10:95173135-95173157 CAGTTCCTGTCCCATGACCAGGG - Intergenic
1074492112 10:113947529-113947551 CATTTCCTCTCCCGTGGGCAGGG - Intergenic
1076143710 10:128099710-128099732 TGGTTCCTCTCCCTTAGCCAAGG - Intronic
1077576040 11:3384197-3384219 CAGTTCCTGTCCCATGACCAGGG + Intergenic
1083779100 11:64909078-64909100 CAGTTCCTCTCCCTTCTCCGGGG + Exonic
1084505246 11:69562890-69562912 CAGTTCCCCTCCCGGGTCAAGGG + Intergenic
1086547693 11:88017158-88017180 CCTTTCCTCTCTCATGTCCATGG - Intergenic
1088909905 11:114183046-114183068 CGGCTCCGCTCACGTGTCCATGG + Intronic
1089364160 11:117910830-117910852 CAGTTCCTATCCTGTTTCCAAGG + Intronic
1092807385 12:12236967-12236989 CAGTCCCTCTCCCCTGCCCAAGG + Intronic
1092905089 12:13093682-13093704 AGGTTCCTCTCCACTGACCAAGG - Intronic
1102800554 12:115729348-115729370 AGGTTCCCATCCCATGTCCATGG - Intergenic
1113249529 13:108436583-108436605 TGTTCCCTCTCCTGTGTCCATGG + Intergenic
1121718019 14:96089914-96089936 CGATCCCTCTCCCCTGTCCTGGG - Exonic
1123048493 14:105529781-105529803 CGGGCCCTGTCACGTGTCCAGGG - Exonic
1129159647 15:73740239-73740261 CGCACCCTCTCCCGTGTCCCTGG + Exonic
1131150534 15:90044789-90044811 TGGCTCCTCTCCTGTGTGCATGG + Intronic
1131733939 15:95312130-95312152 GTGTTCCTTTCCCCTGTCCAGGG - Intergenic
1134492871 16:14708974-14708996 CGGTTCCTGTCCCATGACCAGGG + Intronic
1134498252 16:14748096-14748118 CGGTTCCTGTCCCATGACCAGGG + Intronic
1134582322 16:15380995-15381017 CGGTTCCTGTCCCATGACCAGGG - Intronic
1135313643 16:21425046-21425068 CAGTTCCTGTCCCATGACCAGGG - Intronic
1135366567 16:21857326-21857348 CAGTTCCTGTCCCATGACCAGGG - Exonic
1135445248 16:22513832-22513854 CAGTTCCTGTCCCATGACCAGGG + Exonic
1136193965 16:28638391-28638413 CAGTTCCTGTCCCATGACCAGGG + Exonic
1136310305 16:29403750-29403772 CAGTTCCTGTCCCATGACCAGGG - Exonic
1136323754 16:29505540-29505562 CAGTTCCTGTCCCATGACCAGGG - Exonic
1136438439 16:30245521-30245543 CAGTTCCTGTCCCATGACCAGGG - Exonic
1137484516 16:48880593-48880615 CGGTTCTTCTCACAGGTCCAAGG - Intergenic
1137799240 16:51247423-51247445 CGGCTTCTCTCCAGTGCCCAAGG - Intergenic
1139857988 16:69996136-69996158 CAGTTCCTGTCCCATGACCAGGG - Intergenic
1141578092 16:84977935-84977957 CAGTTCATCTCCTGTGTCCGAGG - Exonic
1142106852 16:88309021-88309043 CCTTTCCTCTCCCCTGCCCAGGG + Intergenic
1142186044 16:88695177-88695199 CGGCTCCTCTCCCTTCCCCAGGG + Intergenic
1147387679 17:40091619-40091641 CCTTTTCTCTGCCGTGTCCATGG - Intronic
1152932653 17:83118053-83118075 CGGTTCCTCTCCCCTGAACGCGG + Intergenic
1154119437 18:11639409-11639431 CAGTTCCTGTCCCATGACCAGGG - Intergenic
1160988886 19:1852587-1852609 GGGCCCCTCTCCAGTGTCCAGGG - Exonic
1165790701 19:38489984-38490006 TGCTTCCTCTCCCCTCTCCATGG - Intronic
1165938622 19:39403897-39403919 GGGTTCCTCTCCTGTAACCAGGG - Intergenic
931245381 2:60488336-60488358 TGGTTCCTCTCCTCTGTCCTTGG + Intronic
932089465 2:68792054-68792076 TGGTCCCTGTCCCGTCTCCAGGG + Intronic
938095481 2:128458644-128458666 CAGTTCTTCTCCAGTGCCCATGG + Intergenic
1178303350 21:31470797-31470819 CGGTTCCTCTCTCTTCTCCTGGG - Intronic
1181542997 22:23583935-23583957 CGCTTCCTCTCCCGAGACCTGGG - Intergenic
1184349746 22:43935877-43935899 CGCTTCCTGTCCCGCATCCAGGG - Intronic
950524156 3:13513800-13513822 CGTTTTCTCTCCTGTGTCCTGGG + Intergenic
950544582 3:13630814-13630836 AGGTACCTCTCCCCTGTCCAAGG + Exonic
974019926 4:56683983-56684005 TGGTTCCTCTCCTGGGTCTAAGG + Intergenic
980795502 4:137677194-137677216 AGGTTCCTCTCCCTTGCACAAGG + Intergenic
981713631 4:147732347-147732369 CGGATCCTCTCCCGGAACCACGG - Exonic
992136673 5:73752958-73752980 AGGTTACTCTCCGGTGACCATGG + Exonic
1012988355 6:105898904-105898926 TGGGTCCTCTCCTGTGCCCAAGG - Intergenic
1013814588 6:114082945-114082967 CCCTTCCCCTCCCTTGTCCAAGG + Intronic
1016997214 6:149969128-149969150 AAGATCCTCTGCCGTGTCCATGG - Exonic
1018788521 6:167128066-167128088 CTTTTCTTCTCCCGTCTCCAGGG + Intronic
1019176909 6:170164656-170164678 TGTTTCCTCTCCCACGTCCAGGG - Intergenic
1020214260 7:6177635-6177657 CGGTTCCTCTCCCGTGTCCATGG - Intronic
1021019446 7:15578371-15578393 CTGTTCCTCTCCCTTTACCAGGG + Intergenic
1030461630 7:109844221-109844243 CTTTTCCTCTCCCATTTCCAAGG + Intergenic
1034105328 7:148484860-148484882 ATGTTCTTCTCCCCTGTCCAAGG + Intergenic
1035391242 7:158506469-158506491 GGGTTCCTCTCCCGTGTGCTTGG - Intronic
1043355249 8:79403868-79403890 CGGTTCTTATCCCTTCTCCAAGG + Intergenic
1046108126 8:109691271-109691293 CAGTTGCCCTCCCGTGTCCGCGG + Intronic
1046704164 8:117432450-117432472 CCATTCCACTCCAGTGTCCATGG + Intergenic
1051353109 9:16216835-16216857 GGCATCCTCTCCCCTGTCCACGG - Intronic
1062268420 9:135697951-135697973 AGGCTCCTCTCCCCTCTCCAAGG - Intronic
1192370109 X:70506137-70506159 CGGTTCCTCCCCAGTGAACAGGG + Intergenic
1192801933 X:74473983-74474005 CGCTTCCTCAGCAGTGTCCATGG + Intronic