ID: 1020214263

View in Genome Browser
Species Human (GRCh38)
Location 7:6177646-6177668
Sequence GGAGAGGAACCGGTTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1020214258_1020214263 -8 Left 1020214258 7:6177631-6177653 CCTCCCATGGACACGGGAGAGGA 0: 1
1: 0
2: 0
3: 5
4: 116
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214252_1020214263 15 Left 1020214252 7:6177608-6177630 CCATAATACGGTAATGCCTCTCT 0: 1
1: 0
2: 0
3: 4
4: 64
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214249_1020214263 24 Left 1020214249 7:6177599-6177621 CCCAGGATCCCATAATACGGTAA 0: 1
1: 0
2: 0
3: 5
4: 51
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214251_1020214263 16 Left 1020214251 7:6177607-6177629 CCCATAATACGGTAATGCCTCTC 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214254_1020214263 -1 Left 1020214254 7:6177624-6177646 CCTCTCTCCTCCCATGGACACGG 0: 1
1: 0
2: 1
3: 15
4: 199
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101
1020214250_1020214263 23 Left 1020214250 7:6177600-6177622 CCAGGATCCCATAATACGGTAAT 0: 1
1: 0
2: 0
3: 3
4: 35
Right 1020214263 7:6177646-6177668 GGAGAGGAACCGGTTGCACTGGG 0: 1
1: 0
2: 1
3: 6
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1020214263 Original CRISPR GGAGAGGAACCGGTTGCACT GGG Intronic